Skip to main content

LentiCRISPRv2-Beclin1
(Plasmid #99574)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99574 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LentiCRISPR V2
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting Beclin1
  • gRNA/shRNA sequence
    CACCGATCTGCGAGAGACACCATCC
  • Species
    H. sapiens (human)
  • Entrez Gene
    BECN1 (a.k.a. ATG6, VPS30, beclin1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-Beclin1 was a gift from Edward Campbell (Addgene plasmid # 99574 ; http://n2t.net/addgene:99574 ; RRID:Addgene_99574)
  • For your References section:

    TRIM5alpha degradation via autophagy is not required for retroviral restriction. Imam S, Talley S, Nelson RS, Dharan A, O'Connor C, Hope TJ, Campbell EM. J Virol. 2016 Jan 13. pii: JVI.03033-15. 10.1128/JVI.03033-15 PubMed 26764007