-
PurposeExpressed Cas9 with sgRNA targeting Beclin1
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneLentiCRISPR V2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting Beclin1
-
gRNA/shRNA sequenceCACCGATCTGCGAGAGACACCATCC
-
SpeciesH. sapiens (human)
-
Entrez GeneBECN1 (a.k.a. ATG6, VPS30, beclin1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPRv2-Beclin1 was a gift from Edward Campbell (Addgene plasmid # 99574 ; http://n2t.net/addgene:99574 ; RRID:Addgene_99574) -
For your References section:
TRIM5alpha degradation via autophagy is not required for retroviral restriction. Imam S, Talley S, Nelson RS, Dharan A, O'Connor C, Hope TJ, Campbell EM. J Virol. 2016 Jan 13. pii: JVI.03033-15. 10.1128/JVI.03033-15 PubMed 26764007