Skip to main content

pLSSmOrange-mKate2
(Plasmid #99868)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99868 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmKate2-N
  • Backbone manufacturer
    Evrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LSSmOrange
  • Promoter CMV
  • Tag / Fusion Protein
    • mKate2 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer pEGFP_Rev: TTTAAAGCAAGTAAAACCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSSmOrange-mKate2 was a gift from Marc Tramier (Addgene plasmid # 99868 ; http://n2t.net/addgene:99868 ; RRID:Addgene_99868)
  • For your References section:

    Multiplexing PKA and ERK1&2 kinases FRET biosensors in living cells using single excitation wavelength dual colour FLIM. Demeautis C, Sipieter F, Roul J, Chapuis C, Padilla-Parra S, Riquet FB, Tramier M. Sci Rep. 2017 Jan 20;7:41026. doi: 10.1038/srep41026. 10.1038/srep41026 PubMed 28106114