EKARdual
(Plasmid
#99870)
-
PurposeMeasure ERK activity by conformational change after ERK substrate phosphorylation and recognition of this phosphorylated substrate
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTriEx4
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEKAR
-
Alt nameErk activity reporter
-
SpeciesSynthetic
- Promoter CMV
-
Tags
/ Fusion Proteins
- mTFP1 (N terminal on backbone)
- ShadowG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer T7: taatacgactcactataggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EKARdual was a gift from Marc Tramier (Addgene plasmid # 99870 ; http://n2t.net/addgene:99870 ; RRID:Addgene_99870) -
For your References section:
Multiplexing PKA and ERK1&2 kinases FRET biosensors in living cells using single excitation wavelength dual colour FLIM. Demeautis C, Sipieter F, Roul J, Chapuis C, Padilla-Parra S, Riquet FB, Tramier M. Sci Rep. 2017 Jan 20;7:41026. doi: 10.1038/srep41026. 10.1038/srep41026 PubMed 28106114