This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Jacob Hanna Lab Plasmids


The Jacob Hanna Lab has deposited plasmids at Addgene for distribution to the research community. Addgene is a nonprofit plasmid repository dedicated to improving life science research.

Learn more about research in the Jacob Hanna Lab.

Addgene Alerts

You must login or create an account to subscribe for Addgene Alerts.

Title Authors Publication
Deterministic direct reprogramming of somatic cells to pluripotency. Rais Y, Zviran A, Geula S, Gafni O, Chomsky E, Viukov S, Mansour AA, Caspi I, Krupalnik V, Zerbib M, Maza I, Mor N, Baran D, Weinberger L, Jaitin DA, Lara-Astiaso D, Blecher-Gonen R, Shipony Z, Mukamel Z, Hagai T, Gilad S, Amann-Zalcenstein D, Tanay A, Amit I, Novershtern N, Hanna JH Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18.
Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30.
SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Naoko Irie, Leehee Weinberger, Walfred W.C. Tang, Toshihiro Kobayashi, Sergey Viukov, Yair S. Manor, Sabine Dietmann, Jacob H. Hanna, M. Azim Surani Cell 160, 1–16, January 15, 2015
Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Maza I, Caspi I, Zviran A, Chomsky E, Rais Y, Viukov S, Geula S, Buenrostro JD, Weinberger L, Krupalnik V, Hanna S, Zerbib M, Dutton JR, Greenleaf WJ, Massarwa R, Novershtern N, Hanna JH Nat Biotechnol. 2015 Jun 22. doi: 10.1038/nbt.3270.
m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Shay Geula, Sharon Moshitch-Moshkovitz, Dan Dominissini, Abed AlFatah Mansour, Nitzan Kol, Mali Salmon-Divon, Vera Hershkovitz, Eyal Peer, Nofar Mor, Yair S. Manor, Moshe Shay Ben-Haim, Eran Eyal, Sharon Yunger, Yishay Pinto, Diego Adhemar Jaitin, Sergey Viukov, Yoach Rais, Vladislav Krupalnik, Elad Chomsky, Mirie Zerbib, Itay Maza, Yoav Rechavi, Rada Massarwa, Suhair Hanna, Ido Amit, Erez Y. Levanon, Ninette Amariglio, Noam Stern-Ginossar, Noa Novershtern, Gideon Rechavi and Jacob H. Hanna Science 1 January 2015
ID Plasmid Gene/Insert Vector Type Publication Hidden Extra Search Info  
52356FUW-Mbd3Mbd3 (Mus musculus)Mammalian Expression, LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Lentiviral expression vector for constitutive expression of Mbd3 FUW Mbd3 AI181826, AU019209 Add to Cart
523585' MBD3 TALENNI NN NN NN NN HD HD NI NN NG NG NN NG NN NN NN NN NG NNTALENDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. TALEN vector for targeting human MBD3 locus (5') pc-GoldyTALEN Add to Cart
523593' MBD3 TALENNN NN HD NN NG NN NI HD HD HD HD NI NN NI HD HD NGTALENDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. TALEN vector for targeting human MBD3 locus (3') pc-GoldyTALEN Add to Cart
52362pNTK human MBD3 PGK-Neo-pA floxMBD3 (Homo sapiens)TargetingDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Targeting vector for Human MBD3 conditional knockout. Also creates hypomorphic alleles. pNTK Add to Cart
52371FUW-Flag-Mbd3Mbd3 (Mus musculus)Mammalian Expression, LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Lentiviral expression vector for constitutive expression of double Flag tagged Mbd3 Fuw Mbd3 AI181826, AU019209 Add to Cart
52372FUW-Flag-Mbd3 delta1-70Mbd3 (Mus musculus)Mammalian Expression, LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Lentiviral expression vector for constitutive expression of double Flag tagged Mbd3 mutant Fuw Mbd3 AI181826, AU019209 Add to Cart
52373FUW-Flag-Mbd3 delta 25-83Mbd3 (Mus musculus)Mammalian Expression, LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Lentiviral expression vector for constitutive expression of double Flag tagged Mbd3 mutant Fuw Mbd3 AI181826, AU019209 Add to Cart
52374FUW-Flag-Mbd3 delta49-63Mbd3 (Mus musculus)Mammalian Expression, LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Lentiviral expression vector for constitutive expression of double Flag tagged Mbd3 mutant Fuw Mbd3 AI181826, AU019209 Add to Cart
52376pBRPy CAGGS-Mbd3-IRES-PUROMbd3 (Mus musculus)Mammalian ExpressionDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Mammalian expression vector for constitutive expression of Mbd3 pBRPy Mbd3 AI181826, AU019209 Add to Cart
52379OCT4-GFP-2A-PURO transgenic reporterGFP-2A-puro (Synthetic), OCT4 (Homo sapiens)Mammalian ExpressionDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. BAC recombineering generated construct, used as a reporter for OCT4 expression minimal Amp vector Add to Cart
52380delta PE OCT4-GFP-2A-PURO transgenic reporterGFP-2A-puro (Synthetic), OCT4 (Homo sapiens)Mammalian ExpressionDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. BAC recombineering generated construct, used as a reporter for OCT4 expression minimal Amp vector POU5F1 OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4 Add to Cart
52381delta DE OCT4-GFP-2A-PURO transgenic reporterGFP-2A-puro (Synthetic), OCT4 (Homo sapiens)Mammalian ExpressionDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. BAC recombineering generated construct, used as a reporter for OCT4 expression minimal Amp vector POU5F1 OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4 Add to Cart
52382mouse deltaPE Oct4-GFP transgenic reporterGFP pA (Synthetic), Oct4 (Mus musculus), PGK-gb2-Neo (Synthetic)Mammalian ExpressionDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. BAC recombineering generated construct, used as a reporter for mouse Oct4 expression pBS KS+ Pou5f1 NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4 Add to Cart
52409pBRY-nuclear mCherry-IRES-PUROnuclear mCherry (Other)Mammalian ExpressionDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Constitutively expressed mammalian expression vector encoding nuclear mCherry fluorescent reporter. Puromycin resistance. pBRPy-CAGGS Add to Cart
52412FOR human OCT4 TALENHD NG NN NN NN HD NG HD NG HD HD HD NI NG (Synthetic)TALENDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. TALEN expressing vector used to allow Knock-in of OCT4-GFP-2A-PURO knockin donor plasmid (generated by Jaenisch lab- Addgene Vector # 31939) pTal4 Add to Cart
52413REV human OCT4 TALENHD HD HD HD HD NI NG NG HD HD NG NI NN NI NI NN NN (Synthetic)TALENDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. TALEN expressing vector used to allow Knock-in of OCT4-GFP-2A-PURO knockin donor plasmid (generated by Jaenisch lab- Addgene Vector # 31939) pTal4 Add to Cart
52414pGL3-human OCT4 DE-SV40-LucDistal element of human OCT4 promoter (Homo sapiens)Mammalian Expression, LuciferaseDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. Luciferase reporter plasmid for DE OCT4 enhancer activity pGL3 promoter Add to Cart
52415pGL3-human OCT4 PE-SV40-LucProximal element of hOCT4 promoter (Homo sapiens)Mammalian Expression, LuciferaseDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. Luciferase reporter plasmid for PE OCT4 enhancer activity pGL3 promoter POU5F1 OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4 Add to Cart
52416FUW-CAGGS-ERASERAS (Homo sapiens)Mammalian Expression, LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Lentiviral vector encoding constitutive expression of human ERAS cDNA FUW-CAGGS ERAS HRAS2, HRASP Add to Cart
52417FUW-TetO-lox-ERASERAS (Homo sapiens)LentiviralDeterministic direct reprogramming of somatic cells to pluripotency. Nature. 2013 Oct 3;502(7469):65-70. doi: 10.1038/nature12587. Epub 2013 Sep 18. Doxycycline inducible lentiviral vector of human ERAS cDNA with excisable insert FUW-TetO- lox ERAS HRAS2, HRASP Add to Cart
52419PBRPyCAG-LoxP-ERAS-STOPcassette-Loxp-DsRed-IRES-PUROERAS (Homo sapiens)Derivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. Constitutive mammalian expression of ERAS. Upon CRE mediated deletion of ERAS insert, dsRED expression markers is truned on due to concomittant removal of stop cassette. addgene 26274 ERAS HRAS2, HRASP Add to Cart
59720Nanog-CreER targeting constructcreERT2 (Synthetic)Mouse TargetingTransient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Nat Biotechnol. 2015 Jun 22. doi: 10.1038/nbt.3270. Cre-ER knockin targeting construct for mouse endogenous Nanog locus pDT Add to Cart
59721Human NANOS3-P2A-mCherry knock-in targeting constructP2A mCherry (Synthetic)Mammalian ExpressionSOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Gene targeting construct for human NANOS3 locus, introducing a P2A-mCherry reporter gene. Contains an frt-PGK-Neo-PA-frt cassette that can be excised. pNeoTK Add to Cart
59722FOR human NANOS3 TALENHD HD NG NH HD NG HD NG HD HD HD NG HD HD NI NG (Synthetic)Mammalian Expression, TALENSOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 TALEN expressing vector used to allow Knock-in of NANOS3-P2A-mCherry knockin donor plasmid (addgene #59721) pc-Goldy TALEN Add to Cart
59723REV human NANOS3 TALENNG NH HD HD HD NI HD HD NG NH NG NI NH NH HD NI (Synthetic)Mammalian Expression, TALENSOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 TALEN expressing vector used to allow Knock-in of NANOS3-P2A-mCherry knockin donor plasmid (addgene #59721) pc-Goldy TALEN Add to Cart
59724Human BLIMP1 sgRNAhBLIMP1 sgRNA (Homo sapiens)Mammalian Expression, CRISPRSOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Plasmid encoding sgRNA to generate BLIMP1 knockout mutant human cells px330 Add to Cart
59725Human SOX17 sgRNAhSox17 sgRNA (Homo sapiens)Mammalian Expression, CRISPRSOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Plasmid encoding sgRNA to generate SOX17 knock-out mutant human cells px330 Add to Cart
59726Human T (BRACHYURY) sgRNAhT sgRNA (Homo sapiens)Mammalian Expression, CRISPRSOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Plasmid encoding sgRNA to generate T (BRACHYURY) knock-out mutant human cells px330 Add to Cart
60037Mouse Nanog locus 3' probeNanog (Mus musculus)Unspecified ; cloningTransient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Nat Biotechnol. 2015 Jun 22. doi: 10.1038/nbt.3270. Cloned genomic fragment of murine Nanog locus used as probe for Southern Blot analysis pCR2.1 Add to Cart
60527mouse Oct4-GFP GOF18 transgenic reporterGFPpA (Synthetic)Mammalian ExpressionDerivation of novel human ground state naive pluripotent stem cells. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. BAC recombineering generated construct, used as a reporter for Oct4 expression (containes both DE and PE elements) pBS KS+ Add to Cart
61514px335 Mettl14 sgRNA #2gccgctcccggatctcctgc (Mus musculus)Mammalian Expression, CRISPRm6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 encodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy) px335 Add to Cart
61515px335 Mettl14 sgRNA #1gcggcagctcctagctcagc (Mus musculus)Mammalian Expression, CRISPRm6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 encodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy) px335 Add to Cart
61516pBRPyCAG-Mettl3-dsRed-IRES-puroMettl3 (Mus musculus)Mammalian Expressionm6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 Constitutive expression of murine wild-type Mettl3 pBRPy Mettl3 2310024F18Rik, M6A, Spo8 Add to Cart