Skip to main content

WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation.

Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E
Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
156452pEN527 - Rad21-AID[71-114]-eGFP-FRT-Blast-FRT targeting constructTargeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG
175549pNQL001-WAPL-AID[71-114]-eGFP-FRT-Neo/Kan-FRT targeting constructTargeting vector to introduce an AID-eGFP cassette at the mouse WAPL locus using Neomycin/Kanamycin selection. Auxin-inducible degron system.
175550pX335-NQL002-WAPL-sgRNA1For transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.
175551pX335-NQL003-WAPL-sgRNA2For transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL002-WAPL-sgRNA1 targeting construct.
175552pNQL004-SOX2-FKBPV-HA2-P2A-mCherry targeting constructTargeting vector to introduce an FKBPV-HA2-P2A-mCherry cassette at the mouse SOX2 locus. Degradation Tag (dTAG) system.
175553pX330-NQL005-SOX2-sgRNAFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.
175554pNQL006-NANOG-FKBPV-HA2-P2A-eGFP targeting constructTargeting vector to introduce an FKBPV-HA2-P2A-eGFP cassette at the mouse NANOG locus. Degradation Tag (dTAG) system.
175555pX330-NQL007-NANOG-sgRNAFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.

Antibodies from Article