Skip to main content

Actc1


Description actin, alpha, cardiac muscle 1
Also known as Actc-1
Species Mus musculus
Entrez ID 11464

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene

ID Plasmid Gene/Insert PI
99690pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Mus musculus) George Church
99691pAAV-CMV-dSa VP64 Actc1dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Mus musculus) George Church
99694pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) George Church
128326pSB700-mouse-ACTC1-PurogRNA against mouse ACTC1 for activation (Mus musculus) Alejandro Chavez