Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

B2m


Description beta-2 microglobulin
Also known as Ly-m11, beta2-m, beta2m
Species Mus musculus
Entrez ID 12010
MGC ID BC085164

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
12099pBJ1-human b2mhuman beta-2-microglobulin (Homo sapiens) Bjorkman
15883pISH-beta2-microglobulinbeta2-microglobulin (Mus musculus) Mombaerts
81263pDONR223_B2M_p.A6VB2M (Homo sapiens) Boehm
81274pDONR223_B2M_p.M1LB2M (Homo sapiens) Boehm
81280pDONR223_B2M_p.M1RB2M (Homo sapiens) Boehm
81281pDONR223_B2M_p.M1VB2M (Homo sapiens) Boehm
81289pDONR223_B2M_p.M1IB2M (Homo sapiens) Boehm
81303pDONR223_B2M_p.D54NB2M (Homo sapiens) Boehm
81308pDONR223_B2M_p.C100SB2M (Homo sapiens) Boehm
81316pDONR223_B2M_p.Y30HB2M (Homo sapiens) Boehm
81810pDONR223_B2M_WTB2M (Homo sapiens) Boehm
116123pHAGE-B2M-L13Sfs*31B2M (Homo sapiens) Scott
116124pHAGE-B2M-M1LB2M (Homo sapiens) Scott
116715pHAGE-B2MB2M (Homo sapiens) Scott
121670pBJ1-rat Beta2mrat beta-2- microglobulin (Rattus norvegicus) Bjorkman
153415A2_uSFFVA*02:01-P2A-human beta2 microglobulin (Homo sapiens) Nakayama
186068pTR-374 tNGFR-P2A-B2MB2M (Homo sapiens) Marson
211368pET-3a_mb2mb2m (Mus musculus) Achour
215545B2M-SDMutation-EPGB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived puromycin-GFP selection cassette (Homo sapiens) Wang
215546B2M-SDMutation-EhTB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (Homo sapiens) Wang
215547B2M-SDMutation-gRNAB2M (Homo sapiens) Wang
215657OPEN Beta2-microglobulinOPEN Beta2-microglobulin (Homo sapiens) Sgourakis
217340gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217341gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217342gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert