|
|
230242 |
AiP12803 - pAAV-AiE0809m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2803) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230240 |
AiP12757 - pAAV-AiE0730m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2757) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230239 |
AiP12753 - pAAV-AiE0668m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2753) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230237 |
AiP12715 - pAAV-AiE0708m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2715) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230236 |
AiP12712 - pAAV-AiE0705m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2712) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230232 |
AiP12695 - pAAV-AiE0693h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2695) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230231 |
AiP12693 - pAAV-AiE0713h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2693) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230230 |
AiP12690 - pAAV-AiE0692h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2690) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230229 |
AiP12686 - pAAV-AiE0648h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2686) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230227 |
AiP12681 - pAAV-AiE0565h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2681) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230226 |
AiP12680 - pAAV-AiE0564h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2680) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230224 |
AiP12678 - pAAV-AiE0562h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2678) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230222 |
AiP12649 - pAAV-AiE0716h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2649) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230221 |
AiP12640 - pAAV-AiE0758m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2640) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230220 |
AiP12627 - pAAV-AiE0734m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2627) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230219 |
AiP12624 - pAAV-AiE0767m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2624) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230218 |
AiP12623 - pAAV-AiE0766m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2623) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230217 |
AiP12605 - pAAV-AiE0773m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2605) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230216 |
AiP12600 - pAAV-AiE0765m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2600) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230215 |
AiP12496 - pAAV-AiE0386h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2496) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230211 |
AiP12431 - pAAV-AiE0483m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2431) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230203 |
AiP12322 - pAAV-AiE0482m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2322) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230202 |
AiP12319 - pAAV-AiE0474m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2319) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230201 |
AiP12310 - pAAV-AiE0131h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2310) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230199 |
AiP12309 - pAAV-AiE0130h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2309) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230197 |
AiP12262 - pAAV-AiE0487m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2262) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230196 |
AiP12260 - pAAV-AiE0485m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2260) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230195 |
AiP12259 - pAAV-AiE0480m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2259) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230193 |
AiP12167 - pAAV-AiE0407h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2167) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230192 |
AiP12164 - pAAV-AiE0404h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2164) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230191 |
AiP12160 - pAAV-AiE0398h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2160) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230190 |
AiP12159 - pAAV-AiE0397h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2159) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230189 |
AiP12152 - pAAV-AiE0389h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2152) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230188 |
AiP12120 - pAAV-AiE0376m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2120) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230186 |
AiP12092 - pAAV-AiE0402m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2092) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230185 |
AiP12091 - pAAV-AiE0398m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2091) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
230184 |
AiP12083 - pAAV-AiE0372m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2083) |
SYFP2 (Synthetic)
|
Levi |
Apr 30, 2025 |
|
|
235493 |
pEGFP-TDP-43 (K408R) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235488 |
pEGFP-TDP-43 (Q331K) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235491 |
pEGFP-TDP-43 (5FL) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
230639 |
AiP1390 - pAAV-AiE2161m-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
235487 |
pEGFP-TDP-43 |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
235492 |
pEGFP-TDP-43 (K136R) |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
230623 |
AiP1327 - pAAV-AiE2068m_3xC2-minBG-SYFP2-WPRE3-BGHpA |
SYFP2 (Synthetic)
|
Tasic |
Apr 30, 2025 |
|
|
207583 |
HaloKu70 sgRNA |
GAGCAGTAGCCAACATGTCA (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
235496 |
pDEST-TDP-43-HA |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
207093 |
DNA-PKcs N-terminal sgRNA |
AGCGGGACTCGGCGGCATGG (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
235495 |
pDEST-TDP-43-SUMO2-HA |
TARDBP (Homo sapiens)
|
Rousseaux |
Apr 30, 2025 |
|
|
207088 |
Halo-DNAPKcs HRD |
HaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences (Homo sapiens)
|
Schmidt |
Apr 30, 2025 |
|
|
214429 |
pLEX_307-SARS-CoV-2-NSP3-V5 |
SARS-CoV-2 NSP3 (part of SARS-CoV-2 ORF1ab) (Other)
|
Babu |
Apr 30, 2025 |