|
|
43978 |
pCoofy34 |
|
Suppmann |
Oct 28, 2013 |
|
|
43977 |
pCoofy12 |
|
Suppmann |
Oct 28, 2013 |
|
|
43976 |
pCoofy7 |
|
Suppmann |
Oct 28, 2013 |
|
|
43975 |
pCoofy18 |
|
Suppmann |
Oct 28, 2013 |
|
|
43974 |
pCoofy1 |
|
Suppmann |
Oct 28, 2013 |
|
|
49058 |
pGL410_Ins2500 |
mouse Ins2 promoter (Mus musculus)
|
Ferreri |
Oct 28, 2013 |
|
|
47054 |
pENTR-HOXA1 |
Homeobox A1 (Homo sapiens)
|
Zoghbi |
Oct 24, 2013 |
|
|
47053 |
pENTR-FOXP2 |
Forkhead Box P2 (Homo sapiens)
|
Zoghbi |
Oct 24, 2013 |
|
|
47382 |
pHT-ads |
ads (Other)
|
Too |
Oct 24, 2013 |
|
|
44635 |
PU.1-W215G LZRS |
PU.1 W215G (Mus musculus)
|
Rothenberg |
Oct 24, 2013 |
|
|
44634 |
PU.1-delta75-100 LZRS |
PU.1 Δ75-100 (Mus musculus)
|
Rothenberg |
Oct 24, 2013 |
|
|
42131 |
pC1-HyPer-3 |
HYPER 3 (Synthetic)
|
Belousov |
Oct 24, 2013 |
|
|
48999 |
C321 |
Recoded E. coli genome with all instances of the UAG codon removed, but wild type UAG termination function is not changed (Other)
|
Church |
Oct 24, 2013 |
|
|
48998 |
C321.ΔA |
Recoded E. coli genome with all instances of the UAG codon and RF1 removed (UAG termination function removed) (Other)
|
Church |
Oct 24, 2013 |
|
|
48190 |
Flag-ATXN1_V591A_S602D |
Ataxin1 (Homo sapiens)
|
Zoghbi |
Oct 23, 2013 |
|
|
48189 |
Flag-ATXN1 |
Ataxin1 (Homo sapiens)
|
Zoghbi |
Oct 23, 2013 |
|
|
48194 |
Flag-ATXN1_L588D |
Ataxin1 (Homo sapiens)
|
Zoghbi |
Oct 23, 2013 |
|
|
48191 |
Flag-ATXN1_V591A_L686E |
Ataxin1 (Homo sapiens)
|
Zoghbi |
Oct 23, 2013 |
|
|
48971 |
pET21 Catalytic Domain of MALT1 Catalytic Mutant |
MALT1 (Homo sapiens)
|
Salvesen |
Oct 23, 2013 |
|
|
48970 |
pET21 Catalytic Domain of MALT1 |
MALT1 (Homo sapiens)
|
Salvesen |
Oct 23, 2013 |
|
|
48967 |
pcDNA3 HA-Sumo2 WT |
SUMO2 (Homo sapiens)
|
Salvesen |
Oct 23, 2013 |
|
|
48966 |
pcDNA3 HA-Sumo1 WT |
SUMO1 (Homo sapiens)
|
Salvesen |
Oct 23, 2013 |
|
|
48965 |
pcDNA3 HA-Sumo1 Q94P |
SUMO1 (Homo sapiens)
|
Salvesen |
Oct 23, 2013 |
|
|
44550 |
pCM305 |
HA-htz1 (Saccharomyces cerevisiae)
|
Grunstein |
Oct 23, 2013 |
|
|
44521 |
p184.3 |
Histone 3 N-terminus (Saccharomyces cerevisiae)
|
Grunstein |
Oct 23, 2013 |
|
|
36448 |
pcDNA3 HA-SUMO2-Q90P |
SUMO2 (Homo sapiens)
|
Salvesen |
Oct 23, 2013 |
|
|
48635 |
ERrefGFP1_pCDNA3 |
ERrefGFP1 (Other)
|
Ron |
Oct 23, 2013 |
|
|
48644 |
refGFP1_pQE30 |
refGFP1
|
Ron |
Oct 23, 2013 |
|
|
48739 |
pET-UNC60A |
C. elegans UNC-60A cDNA (Caenorhabditis elegans)
|
Ono |
Oct 23, 2013 |
|
|
47458 |
LITE2.0 EF1a_TALE(Neurog2)-GS-CIB1(NLS*,∆318-334)_WPRE_hGHpA |
TALE (Neurog2)-GS-CIB1(NLS*,∆318-334) (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47453 |
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpA |
TALE (N136,Grm2,C63)-cib1 (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47452 |
pAAV_hSyn_TALEBB(NI)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA |
TALE BB(N136_0.5NI_C63)-SID4X (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47451 |
pAAV_hSyn_TALEBB(NG)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA |
TALE BB(N136_0.5NG_C63)-SID4X (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47449 |
pAAV_hSyn_TALEBB(NN)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA |
TALE BB(N136_0.5NN_C63)-SID4X (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47447 |
pAAV_hSyn_TALEBB(NG)-NLS-VP64_2A_GFP_WPRE_bGHpA |
TALE BB(N136_0.5NG_C63)-VP64 (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
47445 |
pAAV_hSyn_TALEBB(NN)-NLS-VP64_2A_GFP_WPRE_bGHpA |
TALE BB(N136_0.5NN_C63)-VP64 (Synthetic)
|
Zhang |
Oct 22, 2013 |
|
|
48673 |
M-NM-sgRNA |
sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48672 |
M-ST1-sgRNA |
sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48679 |
M-tdTom-NM |
TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9 (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48678 |
M-tdTom-ST1 |
TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9 (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48677 |
M-tdTom-SP |
TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 (Synthetic)
|
Church |
Oct 22, 2013 |
|
|
48676 |
M-NMn-VP64 |
Cas9-VP64, nuclease-null (Other)
|
Church |
Oct 22, 2013 |
|
|
47978 |
pCAG-VSFP Butterfly 1.2 |
VSFP Butterfly 1.2 (Synthetic)
|
Knopfel |
Oct 22, 2013 |
|
|
42132 |
pQE-30-HyPer3 |
HYPER 3 (Synthetic)
|
Belousov |
Oct 22, 2013 |
|
|
47887 |
pNCMV 18E6no* delPDZ |
HPV 18 E6no* (Other)
|
Munger |
Oct 21, 2013 |
|
|
47866 |
pNCMV 18E6no* I130T |
HPV 18 E6no* (Other)
|
Munger |
Oct 21, 2013 |
|
|
47864 |
pNCMV 11E6 I127T |
HPV 11E6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47863 |
pNCMV 11E6 L111Q |
HPV 11E6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47862 |
pNCMV 6bE6 L129T |
HPV 6bE6 (Other)
|
Munger |
Oct 21, 2013 |
|
|
47861 |
pNCMV 6bE6 I127T |
HPV 6bE6 (Other)
|
Munger |
Oct 21, 2013 |
