Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
195542 pJT300 Lenti pEF-dCas9-3XFLAG-ZNF705_KRAB-T2A-tagBFP-P2A-Blast Lenti pEF-dCas9-3XFLAG-ZNF705_KRAB-T2A-tagBFP-P2A-Blast (Homo sapiens) Bassik May 06, 2024
195541 pJT342 Lenti pEF-dCas9-3XFLAG-RYBP + MGA1+2-T2A-tagBFP-P2A-Blast Lenti pEF-dCas9-3XFLAG-RYBP + MGA1+2-T2A-tagBFP-P2A-Blast (Homo sapiens) Bassik May 06, 2024
195540 pJT341 Lenti pEF-dCas9-3XFLAG-KRAB[WSR7EEE] + RYBP + MGA1+2-T2A-tagBFP-P2A-Blast Lenti pEF-dCas9-3XFLAG-KRAB[WSR7EEE] + RYBP + MGA1+2-T2A-tagBFP-P2A-Blast (Homo sapiens) Bassik May 06, 2024
195538 pJT331 Lenti pEF-dCas9-3XFLAG-Q+N+Z+F-T2A-tagBFP-P2A-Blast Lenti pEF-dCas9-3XFLAG-Q+N+Z+F-T2A-tagBFP-P2A-Blast (Homo sapiens) Bassik May 06, 2024
195537 pJT244 Lenti pEF-dCas9-3XFLAG-RYBP-T2A-tagBFP-P2A-Blast Lenti pEF-dCas9-3XFLAG-RYBP-T2A-tagBFP-P2A-Blast (Homo sapiens) Bassik May 06, 2024
202067 pJT366 AAV-Rapamycin Inducible QNZF AAV-Rapamycin Inducible QNZF (Homo sapiens) Bassik May 06, 2024
202066 pJT365 AAV-Rapamycin Inducible-S3H AAV-Rapamycin Inducible-S3H (Homo sapiens) Bassik May 06, 2024
202064 pJT315 AAV-Rapamycin Inducible-ZNF473KRAB-Citrine AAV-Rapamycin Inducible-ZNF473KRAB-Citrine (Homo sapiens) Bassik May 06, 2024
202063 pJT314 AAV-Rapamycin Inducible-NZ-Citrine AAV-Rapamycin Inducible-NZ-Citrine (Homo sapiens) Bassik May 06, 2024
202062 pJT313 AAV-Rapamycin Inducible-ZF-Citrine AAV-Rapamycin Inducible-ZF-Citrine (Homo sapiens) Bassik May 06, 2024
202061 pJT312 AAV-Rapamycin Inducible-NFZ-Citrine with sNRP-1 terminator AAV-Rapamycin Inducible-NFZ-Citrine with sNRP-1 terminator (Homo sapiens) Bassik May 06, 2024
202060 pJT311 AAV-Rapamycin Inducible-NZF-Citrine AAV-Rapamycin Inducible-NZF-Citrine (Homo sapiens) Bassik May 06, 2024
202059 pJT410 AAV-Rapamycin Inducible-NFZ-Citrine with bGH pA AAV-Rapamycin Inducible-NFZ-Citrine with bGH pA (Homo sapiens) Bassik May 06, 2024
202058 pJT360 AAV-Rapamycin Inducible-noActivator Domain -Citrine AAV-Rapamycin Inducible-noActivator Domain -Citrine (Homo sapiens) Bassik May 06, 2024
202057 pJT310 AAV-BFPdonor AAV-BFPdonor (Homo sapiens) Bassik May 06, 2024
217676 pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL GtACR2-P2A-Voltron2ST (Synthetic) Raimondo May 06, 2024
218093 M13cp-dg1 hp Esvelt May 06, 2024
216213 2C-EGFP-t2a-mCD4 CD4 (Mus musculus) Percharde May 06, 2024
218095 M13cp-dg3 hp Esvelt May 06, 2024
218098 LacI-pLacI-pI pm pI (Other) Esvelt May 06, 2024
218099 LacI-pLacI-pII pm pII (Other) Esvelt May 06, 2024
218100 LacI-pLacI-pIII pm pIII (Other) Esvelt May 06, 2024
218097 LacI pm Esvelt May 06, 2024
218101 LacI-pLacI-pIV pm pIV (Other) Esvelt May 06, 2024
215968 AA294 U1a_v1 (Other) Doench May 06, 2024
215976 AA018 Start; BPNLS_v1.1; VP64_v1.1 (Other) Doench May 06, 2024
214265 pAAV-hsyn-DIO-Rpl22l1-3Flag-2A-eGFP-WPRE Flag-tagged Rpl22I1 protein expressing Cre Recombinase (Mus musculus) Surmeier May 06, 2024
216004 AA020 PP7 Core Protein (PCP)_v1.1 (Other) Doench May 06, 2024
207094 SHLD3 N-terminal sgRNA TTACTGCAGAATGACTACAG (Homo sapiens) Schmidt May 06, 2024
141236 pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE NES-jRGECO1a Cui May 06, 2024
207092 NBS1 C-terminal sgRNA TAAAAAGGAGAAGATAACTG (Homo sapiens) Schmidt May 06, 2024
207099 RNF169 C-terminal sgRNA ACACTTCATTAGGTGCTACT (Homo sapiens) Schmidt May 06, 2024
206619 Anti-c-Fos [N486/25R] anti-c-Fos (Homo sapiens) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
206695 Anti-AMIGO-1 [L86/33R-1] anti-AMIGO-1 (Mus musculus) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
216210 SGLT1(GFP)-MAP17(nb) SGLT1 GFP fusion and MAP17-nanobody fusion (Homo sapiens) Chen May 06, 2024
206717 Anti-Nav1.7 Na+ channel [N68/6R-1] anti-Nav1.7 Na+ channel (Homo sapiens) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
206604 Anti-Kvbeta1.2/KCNAB1 K+ channel [K47/9R] anti-Kvbeta1.2/KCNAB1 K+ channel (Homo sapiens) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
207101 SHLD1 N-terminal sgRNA ATGGCAGGACTATGGCAGCC (Homo sapiens) Schmidt May 06, 2024
206687 Anti-Homer1L/S [L113/130R-1] anti-Homer1L/S (Mus musculus) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
206614 Anti-HCN3 [N141/21R] anti-HCN3 (Mus musculus) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
216211 SGLT2(GFP)-MAP17(nb) SGLT2 GFP fusion and MAP17 nanobody fusion (Homo sapiens) Chen May 06, 2024
207097 ATM C-terminal sgRNA TTTCTAAAGGCTGAATGAAA (Homo sapiens) Schmidt May 06, 2024
218582 peGFP C2-IST1 IST1 (Homo sapiens) Meyer May 06, 2024
218581 peGFP C3-SPG20-PAAA SPG20 (Homo sapiens) Meyer May 06, 2024
218580 peGFP C1-SPG20 SC domain SPG20 (Homo sapiens) Meyer May 06, 2024
217817 mouse b8 full length ITGB8 (Mus musculus) Springer May 06, 2024
218579 peGFP C3-SPG20 8xV SPG20 (Homo sapiens) Meyer May 06, 2024
218578 peGFP C3-SPG20 SPG20 (Homo sapiens) Meyer May 06, 2024
217818 human a5 full length ITGA5 (Homo sapiens) Springer May 06, 2024
214812 pCMV-PE7 PE7 (Synthetic) Adamson May 06, 2024