We narrowed to 74 results for: astl
-
Plasmid#205754PurposeExpression of rsFastLime in mamalian cellsDepositorInsertrsFastLime
ExpressionMammalianMutationwtAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MASTL
Plasmid#23515DepositorInsertMASTL (MASTL Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
MASTL B4.4 gRNA
Plasmid#90755Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation B4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
MASTL gRNA (BRDN0001148591)
Plasmid#75989Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FastLightR-bRaf-mVenus
Plasmid#162155PurposeExpresses FastLightR-bRaf-mVenus in mammalian cellsDepositorInsertFastLightR-bRaf-mVenus
TagsmVenusExpressionMammalianMutationValine 600 is substituted with Glutamic acidPromoterCMVAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_mCherry::Nrv1::vhhGFP4
Plasmid#163926PurposeExpression of GrabFP-B-intracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (intracellular) nanobody with Nrv1 protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_mCherry-CD8-vhhGFP
Plasmid#163930PurposeExpression of Morphotrap-intracellular (Grab-FP-intracellular) under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 nanobody (intracellular) with mouse CD8 transmembrane protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_vhhGFP4::Vkg::mCherry
Plasmid#163929PurposeExpression of GrabFP-ECM under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 nanobody with Viking (Collagen IV) protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectMutationG1767DAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MASTL F3.1 gRNA
Plasmid#90752Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation F3.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MASTL gRNA (BRDN0001148082)
Plasmid#75987Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_vhhGFP4::Nrv1::tagBFP
Plasmid#163925PurposeExpression of GrabFP-B-extracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (extracellular) nanobody with Nrv1 protein and tagBFP fluorophor
UseCre/LoxTagstagBFPExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
MASTL F4.1 gRNA
Plasmid#90753Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation F4.1)
UseCRISPR and LentiviralPromoterU6Available SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
MASTL B3.4 gRNA
Plasmid#90754Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation B3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
MASTL gRNA (BRDN0001149040)
Plasmid#75988Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST ERKKTRrsFastLime
Plasmid#205765PurposeExpression of ERK KTR rsFastLime under CMV promoter (With Puromycin Resistance)DepositorInsertERK KTR rsFastLime
UseLentiviralExpressionMammalianMutationwtAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_mCherry::T48-Baz::vhhGFP4
Plasmid#163928PurposeExpression of GrabFP-A-intracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (intracellular) nanobody with T48 protein, Bazooka minimal localization sequence and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_VHH-GFP4::CD8::mCherry
Plasmid#163917PurposeExpression of a membrane-tethered GFP-nanobody marked by mCherry under control of the UAS or LOP enhancersDepositorInsertFusion of vhhGPF4 nanobody with mouse CD8 transmembrane protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_vhhGFP4::T48-Baz::mCherry
Plasmid#163927PurposeExpression of GrabFP-A-extracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (extracellular) nanobody with T48 protein, Bazooka minimal localization sequence and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only