We narrowed to 9,094 results for: sgRNA
-
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJC.15A.sgRNA.TA
Plasmid#232483PurposesgRNA cloning backbone for expression of sgRNA in C. difficile. Contains TA system to enable maintenence without antibiotic selection.DepositorInsertsToxin-antitoxin System from CD630
medium-copy-number p15A origin of replication
mCherry
UseCRISPRExpressionBacterialPromoterP3 constitutive promoter and native promoterAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lentivirus ABE8e-V106W targeting PEX1-G843D
Plasmid#247667PurposeLentivirus genome encoding ABE8eV106W editor and Sp sgRNA cassette targeting PEX1-G843D mutationDepositorInsertABE8e-V106W editor and PEX1-G843D-targeting sgRNA
UseLentiviralExpressionMammalianPromoterEFSAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T1_gRNA
Plasmid#199332PurposepDEL159; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type I sgRNADepositorInsertszCREST3
Cas9
nrg1 type I sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330-Pten-2
Plasmid#162552PurposesgRNA targeting PtenDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 nicking guide pDY2251
Plasmid#219861PurposeNicking sgRNA for NOLC1DepositorInsertNOLC1 nicking sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFH101
Plasmid#128206PurposesgRNA backbone for StCas9, combine with AtU6-26 promoter module (pFH35)DepositorInsertsgRNA backbone for StCas9, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB-T5E
Plasmid#247330PurposeVector encoding human codon-optimized engineered DelIscB fused with T5E at C-terminal driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB-T5E_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos5a
Plasmid#233461PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b
Plasmid#233464PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-PLXNB2
Plasmid#69240PurposeU6 driven SpCas9 sgRNA expression for PLXNB2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_CNRZ1066
Plasmid#136651PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:CNRZ1066 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:CNRZ_1066 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only