We narrowed to 14,677 results for: cat.1
-
Plasmid#193719PurposeRapalog-inducible coupling to dimeric human kinesin-1 (KIF5B aa1-560) via FKBP for anterograde transportDepositorInserthsKIF5B(1-560)Rigor-L-2xHA-L-FRB (KIF5B Human, Synthetic)
Tags2xHA-FRBExpressionMammalianMutationhsKIF5B(aa1-560), RIGOR: G234APromoterChicken beta-actinAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-hSyn-HA-mTREK-1(S131C/A286F)-IRES-GFP
Plasmid#225490PurposeNeuronal expression IRES-containing bicistronic vector for generating mTREK-1 (S131C/A286F) + EGFP under the hSyn promoter.DepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
UseNeuronal expressionExpressionMammalianPromoterhSynAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75238PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc1 (1/2)DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75240PurposeCRISPR/Cas9 plasmid against human IkarosDepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75232PurposeCRISPR/Cas9 plasmid against human NFATc2DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75236PurposeCRISPR/Cas9 plasmid against human NFATc1DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag
Plasmid#246867PurposeExpress HaloTag-P2A-RSV M2-1-C-terminal-1xSunTag (M2-1exo-SunTag) for RSV imaging.DepositorInsertHaloTag-P2A-RSV M2-1-C-terminal-1xSunTag
UseLentiviralTagsHaloTagExpressionMammalianMutationThe RSV M2-1 protein with a C-terminal insertion …PromoterSFFVAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75242PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/UbC/mSlc7a1
Plasmid#17224DepositorAvailable SinceFeb. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
GoldenPiCS Kit
Plasmid Kit#1000000133PurposeA flexible modular system for advanced strain engineering in Pichia pastoris to accomplish pathway expression, protein production, or other DNA integration applications.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeYeast ExpressionCloning TypeGolden GateAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
YIp211-ADH-myc-E3(1) C885A-CUbo-VSV
Plasmid#212738PurposeConsitutive expression of myc-E3(1) C885A-CUbo-VSV in budding yeast, catalytic inactive E3(1)DepositorInsertE3(1)
UseIntegrative vectorTagsCUbo-NLS-VSV and mycExpressionYeastMutationHOIP(C885A)PromoterADH1Available SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-IRES-GFP ASXL1 (1-479) 3x FLAG
Plasmid#81023PurposeCancer-associated ASXL1 truncation mutant in retroviral vectorDepositorInsertASXL1 (ASXL1 Human)
Tags3X FLAGExpressionMammalianMutationContains ASXL1 amino acids 1-479Promoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MA-VN
Plasmid#123283PurposeMammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)DepositorInsertMatrix
TagsVN: N-terminus of split Venus (a.a. V1–A154) I152…ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_NIX(1-182aa)-THROMBIN-GST (W36A/L39A; deltaLIR)
Plasmid#223738PurposeExpression of recombinant protein for purificationDepositorInsertNIX (BNIP3L) soluble part (BNIP3L Human)
TagsThrombin cleavage-GSTExpressionBacterialMutationW36A/L39A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV2btCRISPRko.v1
Pooled Library#213927PurposeUses lentivirus to deliver the library into hard-to-transduce cellsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_FUNDC1(1-50aa)-THROMBIN-GST (Y18A/L21A; deltaLIR)
Plasmid#223739PurposeExpression of recombinant protein for purificationDepositorInsertFUNDC1 soluble part, mutant (FUNDC1 Human)
TagsThrombin cleavage-GSTExpressionBacterialMutationY18A/L21A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only