We narrowed to 4,733 results for: Gca
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
PCK2 gRNA (BRDN0001487084)
Plasmid#78082Purpose3rd generation lentiviral gRNA plasmid targeting human PCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK18 gRNA (BRDN0001144740)
Plasmid#77880Purpose3rd generation lentiviral gRNA plasmid targeting human CDK18DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IP6K3 gRNA (BRDN0001147058)
Plasmid#77654Purpose3rd generation lentiviral gRNA plasmid targeting human IP6K3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K9 gRNA (BRDN0001145934)
Plasmid#77310Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK3 gRNA (BRDN0001147290)
Plasmid#77313Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DGKD gRNA (BRDN0001148084)
Plasmid#77259Purpose3rd generation lentiviral gRNA plasmid targeting human DGKDDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK4 gRNA (BRDN0001146440)
Plasmid#77224Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLAU gRNA (BRDN0001162395)
Plasmid#77103Purpose3rd generation lentiviral gRNA plasmid targeting human PLAUDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HIPK3 gRNA (BRDN0001146408)
Plasmid#77032Purpose3rd generation lentiviral gRNA plasmid targeting human HIPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32C gRNA (BRDN0001149411)
Plasmid#76933Purpose3rd generation lentiviral gRNA plasmid targeting human STK32CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DGKB gRNA (BRDN0001146143)
Plasmid#76918Purpose3rd generation lentiviral gRNA plasmid targeting human DGKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKG2 gRNA (BRDN0001145745)
Plasmid#76920Purpose3rd generation lentiviral gRNA plasmid targeting human PRKG2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DLG1 gRNA (BRDN0001145356)
Plasmid#76619Purpose3rd generation lentiviral gRNA plasmid targeting human DLG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NRBP2 gRNA (BRDN0001145030)
Plasmid#76455Purpose3rd generation lentiviral gRNA plasmid targeting human NRBP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ULK4 gRNA (BRDN0001145110)
Plasmid#76009Purpose3rd generation lentiviral gRNA plasmid targeting human ULK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HK3 gRNA (BRDN0001149028)
Plasmid#75781Purpose3rd generation lentiviral gRNA plasmid targeting human HK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2A2 gRNA (BRDN0001147190)
Plasmid#75587Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2A2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ETNK1 gRNA (BRDN0001148358)
Plasmid#75532Purpose3rd generation lentiviral gRNA plasmid targeting human ETNK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA6
Plasmid#59310PurposeKnockdown of human FOXH1DepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-PrPro
Plasmid#227454Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgNF2
Plasmid#229433Purposeknockout of NF2DepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt PHGDH
Plasmid#209409PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertPhgdh shRNA (Phgdh Mouse)
UseRetroviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PRDM14_v32_7-6)-PGKpuroBFP-W
Plasmid#211983PurposeExpress gRNA against PRDM14 with puro and BFPDepositorInsertsgRNA targeting PRDM14 (PRDM14 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS2_5-2)-PGKpuroBFP-W
Plasmid#211958PurposeExpress gRNA against ETS2 with puro and BFPDepositorInsertsgRNA targeting ETS2 (ETS2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(15))-PGKpuro2ABFP-W
Plasmid#200499PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(15) (MRPS26 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only