We narrowed to 4,729 results for: TIL
-
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_C433S-GFP fusion
Plasmid#139638PurposeGFP-tagged gene expressionDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PTPRA_C723S-GFP fusion
Plasmid#139639PurposeGFP-tagged gene expressionDepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-R5
Plasmid#62127PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR and Gateway CloningExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE Lenti Dest IFP1.4
Plasmid#62177PurposeMuLE (Multiple Lentiviral Expression) Destination vector for use with pMuLE Entry vectors. Co-expresses IFP1.4 under the control of a PGK promoter. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseLentiviral; Mule gateway destination vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE Lenti Dest Luc2
Plasmid#62179PurposeMuLE (Multiple Lentiviral Expression) Destination vector for use with pMuLE Entry vectors. Co-expresses firefly luciferase under the control of a PGK promoter. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseLuciferase; Mule gateway destination vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK-HA-TRAF4
Plasmid#58314PurposeHA-tagged mouse TRAF4DepositorAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L4
Plasmid#62129PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR and Gateway CloningExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hBnvy
Plasmid#18969DepositorInsertBrevican uncleavable (BCAN Human)
ExpressionMammalianMutationMutation at the ADAMTS cleavage site ESE/SRG: S…Available SinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/FLAG-hPMR1-Tev-Bio
Plasmid#80125PurposeExpresses human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tagsDepositorInsertPXDNL-003 (PXDNL Human)
TagsFLAG and biotinylationExpressionMammalianPromoterCMV promoterAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold-CAF1-C-10
Plasmid#158003PurposeVisualization of nucleus in mammalian cells using mGoldDepositorAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PKAsub-YPet-NES
Plasmid#138203PurposeEncodes C-terminal (substrate) fragment of FRET-based bimolecular PKA activity reporter (BimAKAR); cytosol targeted. Use in conjunction with pcDNA3-Cerulean-FHA1-NES.DepositorInsertPKAsub-YPet-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceApril 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOCC94
Plasmid#118912Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with honey bee melitine secretion signal, N-terminal MBP, cleavable with 3C protease, and C-terminal eGFP-HIS6DepositorInsertNcoI-HBMss-MBP-3C-NotI-ccdB-AscI-eGFP-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and eGFP-HIS6ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 Luc2 (FF-Luciferase) L3-L2
Plasmid#62171PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseGateway Cloning and LuciferaseExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 Luc2 (FF-Luciferase) L5-L2
Plasmid#62170PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseGateway Cloning and LuciferaseExpressionMammalianPromoterSV40Available SinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO Plk4 KD ∆24-mCherry
Plasmid#80272Purposemammalian expression plasmid for kinase dead Plk4 with multi-phospho degron deletedDepositorInsertPlk4 (PLK4 Human)
TagsmCherryExpressionMammalianMutationdeletion of multi-phospho degron (amino acids 282…PromoterCMVAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC254
Plasmid#118889Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal mCherry, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mCherry-TEV-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; mCherry, cl…ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt1-GST
Plasmid#39287DepositorInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Mutation-1163 to +6 of nmt1 locus with a 4bp deletion (TA…Available SinceSept. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
KZ501: pMVP (L3-L2) P2A-Puro + polyA
Plasmid#121780PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Puro + polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV CreERT2 L5-L2
Plasmid#62172PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and CreERT2 module. Compatible with MultiSite Gateway cloningDepositorInsertCreERT2
UseGateway CloningExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR 7SK-miR-30 L5-L4
Plasmid#62119PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a 7SK RNA polymerase III promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L2
Plasmid#62130PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR and Gateway CloningExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only