We narrowed to 13,758 results for: LIC
-
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-Akna-mOrange2
Plasmid#196893PurposeNeuron-specific expression of Akna fused to mOrange2. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Akna-mOrange2
Plasmid#196880PurposeNeuron-specific expression of the centrosomal protein Akna fused to mOrange2DepositorAvailable SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-2xHA-128-425-Akap9
Plasmid#196897PurposeNeuron-specific expression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to 2xHA-tags.DepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-mOrange2-NEDD1-gTBD
Plasmid#196894PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange aimed to displace endogenous gamma-TuRC from the centrosome. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertN-gTBD-mOrange2 (NEDD1 Human)
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only