We narrowed to 55,781 results for: plasmid
-
Plasmid#237133PurposeExpress E6-HaloTag(R) Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertE6
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHnS 2comp Donor;smFP-V5 KO;Gphn#2
Plasmid#240308PurposeDonor:smFP-V5 KO:Gphn#2DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#1
Plasmid#240307PurposeDonor:smFP-V5 KO:Gphn#1DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EP001: pLenti CMV Blast::eGFP-RC-I-1-H11
Plasmid#209301PurposeExpression plasmid for RC-I-1-H11 (de novo virus-like particle designed by David Baker lab) with N-terminal eGFPDepositorInsertRC-I-1-H11
UseLentiviralTagseGFPAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EP002: pLenti CMV Blast::HaloTag-RC-I-1-H11
Plasmid#209302PurposeExpression plasmid for RC-I-1-H11 (de novo virus-like particle designed by David Baker lab) with N-terminal HaloTagDepositorInsertRC-I-1-H11
UseLentiviralTagsHaloTagAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_PTCHD4
Plasmid#232392Purposechr6:48472983-48473484 cloned into pGL3DepositorInsertPTCHD4 (PTCHD4 Human)
UseLuciferaseAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_IMPG1
Plasmid#232362PurposeEnhancer near IMPG1, chr6:76224940-76225441 cloned into pGL3DepositorInsertIMPG1 (IMPG1 Human)
UseLuciferaseAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_rightneg0topos1
Plasmid#232389PurposeMSR1 enhancer, right buffering Coordinator to sensitizing CoordinatorDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MigR1 GFP Mouse PHGDH
Plasmid#220591PurposeRetroviral mammalian expression vector with GFP for overexpression of mouse PHGDHDepositorInsertMs PHGDH (Phgdh Mouse)
UseRetroviralAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_VPS13B
Plasmid#232368PurposeEnhancer near VPS13B, chr8:99439983-99440484 cloned into pGL3DepositorInsertVPS13B (VPS13B Human)
UseLuciferaseAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_C8orf76
Plasmid#232364PurposeEnhancer near C8orf76, chr8:123232060-123232824 cloned into pGL3DepositorInsertC8orf76 (C8orf76 Human)
UseLuciferaseAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLaG2-T7RNAPC
Plasmid#216337PurposeArabinose-inducible PBad promoter driving expression of the anti-eGFP nanobody LaG2 translationally fused to the C-terminal portion (residues 180-883) of T7RNAPDepositorInsertLaG2-T7RNAPC fusion
ExpressionBacterialMutationg2658a, g3915aAvailable SinceJan. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
pLV-SFFV-mCherry-WPRE-UbC-MCS
Plasmid#211801PurposeLentiviral vector plasmid expressing mCherry under the spleen focus-forming virus (SFFV) promoter and containing a multiple cloning site (MCS) under the Ubiquitin C (UbC) promoterDepositorInsertsmCherry
multiple cloning site
UseLentiviralExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
mBeta4/pCNA3.1
Plasmid#197316PurposePlasmid expressing an antigen used to generate an antibody that targets the BK beta4 potassium channel subunitDepositorAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CTHRC1A-c001
Plasmid#205105PurposeCTHRC1 protein expressionDepositorAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only