We narrowed to 15,147 results for: ung
-
Plasmid#136040PurposeUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pGFP Glra2 KA (CC#303)
Plasmid#15201DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-3'UTR
Plasmid#136049PurposeSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiN 6bE6
Plasmid#37447PurposeLentiviral expression of HPV 6bE6 in mammalian cellsDepositorAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDRf1-SweetTrac1
Plasmid#169083PurposeExpression of SweetTrac1 biosensor in yeastDepositorInsertSweetTrac1
ExpressionYeastPromoterPMA1Available SinceFeb. 4, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pNCMV 16E6no* I128T
Plasmid#47706PurposeDefective for E6AP bindingDepositorInsertHPV 16 E6no* (E6 HPV)
TagsFLAG and HAExpressionMammalianMutationdel first 7 aa, I128T, V42L*PromoterCMVAvailable SinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL719
Plasmid#140389PurposeExpresses QacR protein under the control of T7-lacO promoterDepositorInsertT7-lacO-QacR-T
Tags6XHisExpressionBacterialAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL721
Plasmid#140391PurposeExpresses TtgR protein under the control of T7-lacO promoterDepositorInsertT7-lacO-TtgR-T
Tags6XHisExpressionBacterialAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPV033
Plasmid#178359PurposeTargeted gene knock-in plasmid for Schizophyllum communeDepositorInsertsLeft flank
nour_cassette
Right flank
UseFungal homologous recombination plasmidPromoterS. commune gpd and n.a.Available SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-ZC3H15
Plasmid#136015PurposeZC3H15 3'UTR (NM_018471.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pAW79.pUC19.noYY1
Plasmid#104377PurposeNo YY1 binding motifs as control for in vitro ligationDepositorInsertNo YY1 binding motifs
Available SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW49.pUC19.YY1
Plasmid#104376PurposeContains YY1 binding sites for in vitro ligationDepositorInsertYY1 binding motifs
Available SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCY 3010-07
Plasmid#36212DepositorInsertStreptoalloteichus hindustanus bleomycin (Sh ble)
UseYeast cassette for pcr and homologous recombinati…TagsyEpolylinker-Cerulean-ZeocinAvailable SinceJune 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pLentiN 18E6no*
Plasmid#37446PurposeLentiviral expression of HPV 18E6no* in mammalian cellsDepositorInsertHPV 18E6no* (E6 HPV)
UseLentiviralTagsFlag and HAExpressionMammalianMutationV44APromoterCMVAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
cmv 16 E7 C91S
Plasmid#13689DepositorAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU2-CDS
Plasmid#136050PurposeSTAU2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GATATGAACCAACCTTCAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU2-3'UTR
Plasmid#136051PurposeSTAU2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCAGGTAGTTGTTAGTGTTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only