We narrowed to 7,945 results for: Lif;
-
Plasmid#133244PurposeFluorescent reporter for neuropeptide release imagingDepositorInsertdrosophila tachykinin-fused codon-optimized GCaMP6s
ExpressionInsectPromoterhsp70Available SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSynapsin SV-tag
Plasmid#163685Purposeexpress SV-Tag construct in a Cre-independent mannerDepositorInsertsynatophysin 9X HA tag T2A tdtomato
UseAAVTags9X HAExpressionMammalianPromotersynapsinAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQIq_MRGS_HIS8_(27G2)_FLAG
Plasmid#199616PurposeEncodes DARPin-FLAG 27G2 for bacterial expression and column purificationDepositorInsertDARPin-FLAG 27G2
Tags8xHis and FLAGExpressionBacterialPromoterT5Available SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP34
Plasmid#65512PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-t7TFPt9-cMycExpressionYeastPromoterpPMA1Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDC20
Plasmid#131366Purposeexpression of MEG-3 (aa1-862) in C. elegansDepositorAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-muSOX
Plasmid#131701Purposeexpresses muSOX with GFP N-terminally fusedDepositorAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP37
Plasmid#65515PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-Cit-attR1 and attR2-Cer-cMycExpressionYeastPromoterpPMA1Available SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP36
Plasmid#65514PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-Cer-cMycExpressionYeastPromoterpPMA1Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX6-2 SNAP-Syk tSH2
Plasmid#113028Purposefor purification of Syk tSh2. Purified protein will have a snap tag that can be conjugated to fluorescent dyes.DepositorInsertSNAP-Syk tSH2
TagsSNAPExpressionBacterialAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only