We narrowed to 4,633 results for: DUR
-
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO(R285A)-NES
Plasmid#238921PurposeExpression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO(SERT-HA)-3xmiR122-WPRE-HGHpA
Plasmid#220937PurposeFLP-dependent serotonin transporter overexpression vector for non-invasive gap junction tracingDepositorAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB26 (punc-17::GtACR2::mCerulean::βHK::Chrimson)
Plasmid#214889PurposeExpresses the optogenetic tool BiPOLES in cholinergic neurons of C. elegans.DepositorInsertGtACR2_mCerulean_bHK_Chrimson
TagsmCeruleanExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB27 (pmyo-3::GtACR2::mCerulean::βHK::Chrimson)
Plasmid#214890PurposeExpresses the optogenetic tool BiPOLES in BWMs of C. elegans.DepositorInsertGtACR2_mCerulean_bHK_Chrimson
TagsmCeruleanExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
ExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB31 (punc-47::GtACR2::mCerulean::bHK::Chrimson)
Plasmid#214891PurposeExpresses the optogenetic tool BiPOLES in GABAergic neurons of C. elegans.DepositorInsertGtACR2_mCerulean_bHK_Chrimson
TagsmCeruleanAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EF1a-Il1a-ZsGreen
Plasmid#231987PurposeExpress IL-1alpha-ZsGreen fusion proteinDepositorInsertIL-1alpha-ZsGreen fusion construct
UseLentiviralAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B-TdLanYFP
Plasmid#228565PurposeEncodes an acceptor-only, TdLanYFP-tagged version of the LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B G120A
Plasmid#228563PurposeEncodes a donor-only, Aquamarine-tagged version of the inactive LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Aquamarine-LC3B
Plasmid#228559PurposeEncodes a donor-only, Aquamarine-tagged version of the LC3B biosensor under the control of the CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLXB3o1_hygR-MAR10-New BeYDV geminino-SP-nano72VHH-IgG1-MAR10 (GB4954)
Plasmid#225441PurposeModule for stable transformation of Geminino 1.0-n72_h_HC flanked by two MAR10 insulators and next to a Hygromycin resistance cassette.DepositorInserthygR:MAR10:New BeYDV geminino:SP-nano72VHH-IgG1:MAR10
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PRKCZ-C1 (N-PRKCZ-C1)
Plasmid#217760PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC1 domain (aa 123-193)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits