We narrowed to 5,240 results for: codon optimized
-
Plasmid#118449PurposeProduces equimolar expression of yeast codon-optimized tagRFPT and mTq2DepositorInsertyotagRFPT-T2A-mTurquoise2
ExpressionYeastAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNB2629
Plasmid#113394PurposeMET25p-MS2-RFP-CYC1 TTDepositorInsertMS2 bacteriophage coat protein
Tagsred fluorescent protein (RFP), codon-optimized fo…ExpressionYeastAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrascomG12D
Plasmid#206844PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a G12D mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
TagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…Available SinceOct. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrascomQ61R
Plasmid#206845PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a Q61R mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
TagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV Retrograde)
Viral Prep#87306-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A10.T)
Viral Prep#157970-AAV.A10.TPurposeReady-to-use AAV6(dbY-F+T-V) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A08.T)
Viral Prep#157970-AAV.A08.TPurposeReady-to-use AAV2(4pMut)dHS in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSR13
Plasmid#69155Purposeread-outloxN mCherry to GFP switch, with swsn-1 promoter, gene (partially cDNA) and UTR, for integration on on ttTi5605, Mos Chr IIDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0, codon-optimzed index 1.…Promoterrps-27 and swsn-1Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1137
Plasmid#84827PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1955
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
miCBE
Plasmid#205413PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with APOBEC3A and UGI driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6__RNA*_pCAG_bpNLS_APOBEC3A(W104A)_XTEN_OgeuIscB*(D61A)_NLS_2xUGI_bGHployA_pCMV_mCherry
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1415
Plasmid#84828PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-tdTomato
Plasmid#62516PurposeExpresses tdTomato under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing proceduresDepositorInserttdTomato
UseAAV and Synthetic BiologyExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only