We narrowed to 3,032 results for: 2-Oct
-
Plasmid#91478PurposeProtein expression and purification of human SH3 domain construct UBASH3A-1/1DepositorInsertUBASH3A-1/1 (UBASH3A Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCGN-HCF-1-N1011Δ382-450
Plasmid#92322PurposeN-term of HCF-1 protein without amino acids 382-450DepositorInsertHCF-1 (HCFC1 Human)
TagsHAExpressionMammalianMutationAA 2-1011 with internal deletion Δ382-450PromoterCMVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SLA2-1/1
Plasmid#91450PurposeProtein expression and purification of human SH3 domain construct SLA2-1/1DepositorInsertSLA2-1/1 (SLA2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pME18S-3HA-mULK2(K39T)
Plasmid#22899DepositorInsertUNC-51-like kinase 2 (Ulk2 Mouse)
Tags3xHAExpressionMammalianMutationchanged Lysine 39 to ThreonineAvailable SinceSept. 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st WW mutant
Plasmid#18998DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-2nd WW mutant
Plasmid#18999DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 258 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a F656A
Plasmid#53054PurposeExpresses alpha subunit of F656A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Phenylalanine 656 to AlaninePromoterSP6Available SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a Y652A
Plasmid#53053PurposeExpresses alpha subunit of Y652A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Tyrosine 652 to AlaninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN061
Plasmid#91594PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETDuet::dddA11-MBP/dddI
Plasmid#248876PurposeExpression of DddA11-MBP and its immunity protein in bacterial cells for protein purificationDepositorInsert6His-DddA11-TEV-GSlinker-MBP, DddI
ExpressionBacterialAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW-EGFP-mPkm2
Plasmid#242812PurposeLentiviral vector expressing mouse Pkm2 tagged with an N-terminal EGFPDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Lck-mCherry-ibARK
Plasmid#241241PurposeExpression of plasma membrane-tethered ibARK in astrocytesDepositorInsertLck-mCherry-ibARK
UseAAVAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-mCherry-CAAX
Plasmid#223674PurposeAAV expression of mCherry from hSyn1 promoterDepositorInsertmCherry-CAAX
UseAAVPromoterhSyn1Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Nrdj1)
Plasmid#241408PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Figure 2 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pShuttle.Cre
Plasmid#192930PurposeGateway compatible vector with BsaI cloning site and Cre expressionDepositorTypeEmpty backboneUseGateway-compatible cloning vectorPromoterCMVAvailable SinceDec. 9, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits