We narrowed to 2,350 results for: crispr system
-
Plasmid#123735PurposeEncodes rapamycin and tamoxifen activated split-dCAS9 (C-terminal) as a Type 3 part to be used in the MTK systemDepositorInsertERT2-fkbp-spdCa9(205-1368)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV dCas9-MC (eGFP)
Plasmid#89931PurposeExpresses the dCas9-MC fragment only of the sMTase system for targeted DNA methylation in mammalian cells. Contains a eGFP marker expressed off separate promoter.DepositorInsertdCas9-MC
UseTagsFlagExpressionMammalianMutationdeactivated Cas9, fragment of M.SssI (residues 27…PromoterCMVAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
MTK234_027
Plasmid#123907PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 1) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA1 -hThal5.10-2_hg18
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_001
Plasmid#123924PurposeEncodes the spCas9 gRNA GFP dropout expression cassette with ConLS and ConRE connectors with Ampicillin resistance as a type 0 part to be used in the MTK systemDepositorInsertTU-sgRNA - L1/RE
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MTK0_004
Plasmid#123961PurposeEncodes the Cas9 cROSA26 homology destination with Blasticidin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInsertcRosa26 destination
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_005
Plasmid#123992PurposeEncodes the spCas9 sgRNA1 cROSA26 (homology arm 1) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA for cROSA homology arm-1)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_006
Plasmid#123993PurposeEncodes the spCas9 sgRNA1 cROSA26 (homology arm 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA for cROSA Homology arm-2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_007
Plasmid#123994PurposeEncodes the spCas9 sgRNA1 cROSA26 (homology arm 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA for cROSA Homology arm-3
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_054
Plasmid#123959PurposeEncodes the saCas9 CXCR1 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertCXCR4 sa sgRNA 3
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_056
Plasmid#123921PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (human u6 promoter and constant region 3) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-hu6_20N_cr3
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_028
Plasmid#123908PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA2 -hThal5.10-2_hg18
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_029
Plasmid#123909PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA3 -hThal5.10-2_hg18
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_018
Plasmid#123733PurposeEncodes rapamycin and tamoxifen activated split-dCAS9 (N-terminal) as a Type 3 part to be used in the MTK systemDepositorInsertspdCas9(1-204)-frb-D10A-ERT2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_019
Plasmid#123734PurposeEncodes tamoxifen activated split-dCAS9 (N-Terminal) as a Type 3 part to be used in the MTK systemDepositorInsertspdCas9(1-204)-ERT2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only