We narrowed to 4,644 results for: pes
-
Plasmid#136452PurposeMammalian expression plasmid for HCMV glycoprotein O (Merlin strain) fused to superfolder GFPDepositorInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsGly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pH3R-P2A-mCherry-N1
Plasmid#84332PurposeCo-expresses (untagged) Histamine-3 receptor and mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-8his (Merlin)
Plasmid#136454PurposeMammalian expression plasmid for HCMV glycoprotein O (Merlin strain) with an 8his tagDepositorInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsLinker and 8his tag (GGSGHHHHHHHH, includes BamHI…ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Utf1-KI-3'UTR-2A-tdTomato-RBGpA
Plasmid#128834PurposeKnock-in of tdTomato into mouse Utf1 locusDepositorInserttdTomato into Utf1 locus (Utf1 Mouse)
UseMouse TargetingAvailable SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-Rpb1-linker
Plasmid#138468PurposeExpresses GST-tagged Rpb1 linker in bacteriaDepositorInsertRpb1 (POLR2A Human)
TagsGSTExpressionBacterialMutationAmino acids 1460-1585PromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-mu24-ORF24-2xStrep
Plasmid#138453PurposeExpresses mu24-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorInsertmu24-ORF24 (ORF24 MHV68/KSHV)
TagsStrepExpressionMammalianMutationmu24 amino acids 1-191 fused to ORF24 amino acids…PromoterCMVAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Utf1 gRNA
Plasmid#128842PurposegRNA for targeting mouse Utf1 locus using CRISPR-cas techniqueDepositorInsertUtf1 gRNA (Utf1 Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSFG-TFII-I-GFP Y248&249F
Plasmid#22196DepositorInsertTFII-I (GTF2I Human)
UseRetroviralTagsGFPExpressionMammalianMutationChanged Tyrosines 248 and 249 to Phenylalanines. …Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - delta Y
Plasmid#60393PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) without Cterminal tyrosine (delta Y)DepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4)PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSFV_Nb139-NLS-VP64 (3'UTR)_RLEloop
Plasmid#240256PurposeAttenuated PROTEUS vector with Nb139-VP64 transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertnanobody Nb139
TagsNLS-VP64ExpressionMammalianMutationVP64 = 4*VP16[aa437-447]PromoterSFV subgenomic promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-HA-UBA7-Trp311*
Plasmid#251244PurposeExpression of UBA7 with nonsense mutation (Trp311 Stop)DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGuide-NTRK1
Plasmid#246657PurposeGuide RNA for human NTRK1DepositorInsertNTRK1 guide RNA (NTRK1 Human)
UseCRISPRAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-FLAG-coK8
Plasmid#235542PurposeTo express tagBFP-2A-FLAG-coK8 (co = codon-optimized)DepositorInsertK8
UseLentiviralTagsFLAGAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-coICP0-∆USP7
Plasmid#235540PurposeTo express tagBFP-2A-coICP0-∆USP7 (ICP0 ∆618-633, co = codon-optimized)DepositorInsertICP0-∆USP7
UseLentiviralMutationDeletion of region ∆618-633.Available SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAD131_hIrg1_M154I_pCMV6
Plasmid#239120PurposehACOD1 with M154I mutation in mammalian expression vectorDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
TagsMyc and FLAGExpressionMammalianMutationM154IPromoterCMVAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmBorealin-OLLAS
Plasmid#237439PurposeExpresses mouse Borealin tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)DepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only