We narrowed to 2,350 results for: crispr system
-
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN396 - pCAGGS-Tir1-V5-2A-PuroR TIGRE donor
Plasmid#92142PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection (2A-fusion). Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
MT-AvrXa10-FT
Plasmid#234373PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-GFP-AvrXa10-GB1) with optimized activation domain (AvrXa10), targeting Arabidopsis FT locusDepositorInsertsNbGP41-GFP-AvrXa10-GB1
dCas9-24XGP41
gRNAs targeting FT locus
RFP
UseSynthetic BiologyTagsGB1, GFP, and GP41ExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and Arabidopsi…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN114 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt-Rosa26
Plasmid#92143PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianMutationPromoterAvailable sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorInsertAutophagy Related 7 (Atg7 Mouse)
UseRetroviralTagsExpressionMutationPromoterU6Available sinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTK234_055
Plasmid#123920PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (bovine u6 promoter and constant region 2) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-for Sp Cas9 bu6_20N_cr2
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only