We narrowed to 2,670 results for: c-Myc-promoter
-
Plasmid#128734PurposeGateway destination pUC18R6KT-Tn7T-PavrPto-GW-Cya-Km vector for integration into DC3000D36E genome glmS-linked attTn7 site any effector gene, expressed from avrPto promoter and with C-terminal Cya tagDepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pJK511
Plasmid#71591PurposeProduces Thermoplasma acidophilum citrate synthase with C-terminal His6 tag, His222>Gln mutant (TpCSH6-H222Q)DepositorInsertcitrate synthase
TagsHis6ExpressionBacterialMutationchanges histidine-222 to glutaminePromoterT7 promoterAvailable SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNC-Y
Plasmid#238998PurposeNode C carrying sgRNA-1 that can be used for the assembly of pEND-11Y or pEND-ZYDepositorInsertsgRNA-1 downstream of a weak constitutive promoter and a binding site for sgRNA-2
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHBJT014
Plasmid#225165PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (SmR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in opposite orientation of lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT013
Plasmid#225164PurposeLow copy cloning vector for integration of C-terminal FLAG epitope tag (SmR). SmaI restriction site immediately upstream of the FLAG epitope. FLAG epitope in same orientation as lac promoter.DepositorTypeEmpty backboneUseSynthetic BiologyTagsFLAG epitope tag (35 bp)ExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mScarlet-I-mNeonGreen-ADH1term-TEFpr-hphΔC (pKBJ011)
Plasmid#173462PurposeC-SWAT donor for Selection Reconstitution tagging, contains mScarletI-mNeonGreen tandem fluorescent protein timerDepositorInsertmScarlet-I-mNeonGreen
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mCherry-mNeonGreen-ADH1term-TEFpr-hphΔC (pJJF004)
Plasmid#173460PurposeC-SWAT donor for Selection Reconstitution tagging, contains mCherry-mNeonGreen tandem fluorescent protein timerDepositorInsertmCherry-mNeonGreen
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mCherry-sfGFP-ADH1term-TEFpr-hphΔC (pJJF002)
Plasmid#173458PurposeC-SWAT donor for Selection Reconstitution tagging, contains mCherry-sfGFP tandem fluorescent protein timerDepositorInsertmCherry-sfGFP
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_KLF4
Plasmid#140104PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFLAG_attP
Plasmid#110095PurposeVector for low-level constitutive expression in mycobacteria from the Tet promoter. Lacks the Tet repressor. Contains attP for chromosomal integration. Lacks the integrase and thus remains stably integrated in the absence of antibiotic selection. Contains a C-terminal 3xFLAG to allow detection of expression levels by Western blotting.DepositorTypeEmpty backboneTags3xFLAGExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PE7-2A-BSD
Plasmid#234073PurposeFor lentiviral expression of PE7 with blasticidin resistanceDepositorInsertPE7
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_PEmax-2A-MLH1dn-2A-BSD
Plasmid#234072PurposeFor lentiviral expression of PEmax with MLH1dn and blasticidin resistanceDepositorInsertPEmax-2A-MLH1dn
UseCRISPR and LentiviralTagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterEF-1α core promoterAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-bpNLS-hPol eta-2A-tagBFP-bGHpA
Plasmid#193968PurposeEncodes a wildtype human Pol? (eta) with P2A-tagBFP marker driven by CAG promoterDepositorAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-aaAFB2
Plasmid#207839PurposeInducible AFB2 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsatAFB2
mCherry
miniIAA7
VHH-GFP4
Tags3X FLAG-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Cdx2-3xT7
Plasmid#200891PurposeInducible lentiviral expression of Cdx2DepositorInsertCdx2 (Cdx2 Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-miniTurbo-NRF1-FL
Plasmid#237453PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of miniTurbo fused to full-length NRF1 isoformDepositorInsertNRF1 full length
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-Eomes-3xT7
Plasmid#200888PurposeInducible lentiviral expression of EomesDepositorInsertEomes (Eomes Mouse)
UseLentiviral; Doxycycline inducibleTags3xT7ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only