We narrowed to 6,736 results for: Mos
-
Plasmid#64877Purposelentiviral expression of human POLQ K121M mutant (a mutation in the conserved ATP-binding site of the Walker A motif in the helicase-like domain)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M, a mutation in the conserved ATP-binding si…PromoterEF1alphaAvailable sinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC-BAR-YR
Plasmid#61766PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing bar gene (for resistance against glufosinate ammonium) on transfer DNA (TDNA).DepositorInsertsBar gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…TagsExpressionMutationPromotertrpC promoterAvailable sinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-EGFP-SHP2DA
Plasmid#12286DepositorInsertSHP-2DA (PTPN11 Human)
UseTagsMycExpressionMammalianMutationAspartic Acid 425 mutated to AlaninePromoterAvailable sinceAug. 11, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsUseTagsExpressionInsectMutationPromoterAvailable sinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
NC15 pGLUE CUL3
Plasmid#36970DepositorInsertCUL3 (CUL3 Human)
UseTagsCBP tag, HA, and streptagExpressionMammalianMutationPromoterCMVAvailable sinceJuly 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
H14-MBP-SUMO-Cys-Linker-BAF_G47E
Plasmid#101779PurposeExpresses His-MBP-tagged mutant BAF (G47E) in E.coli (SUMO-cleavable)DepositorInsertBAF (BANF1) (BANF1 Human)
UseTagsHis14-MBP-SUMOExpressionBacterialMutationG47E mutationPromoterT5Available sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pOD2087-trnDEG
Plasmid#89369PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)ExpressionMutationPromoterPmec-18Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p4949 pLPCX-His-Xpress NLS hBrd4 CTD
Plasmid#14459DepositorInsertBrd4 CTD (BRD4 Human)
UseRetroviralTagsSV40 NLSExpressionMammalianMutationamino acids 1047-1362 of Brd4 (the CTD). Function…PromoterAvailable sinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
Frt-V5-hspB2
Plasmid#63103PurposeExpression of HSPB2 (small HSP) tagged with V5 in mammalian cellsDepositorInserthspb2 (HSPB2 Human)
UseTagsV5ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RASEFIR-HA
Plasmid#46863Purposeexpresses mouse IL-17RA with SEFIR deletionDepositorInsertIL-17RA-delta-SEFIR (Il17ra Mouse)
UseTags3x HAExpressionMammalianMutationDeletion of SEFIR domain (AA 394-485)PromoterCMVAvailable sinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta ZF2
Plasmid#84026PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 35-58; Q394RPromoterUCOE / SFFVAvailable sinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUT BuGZ delta ZF1
Plasmid#84025PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 13-34; Q394RPromoterUCOE / SFFVAvailable sinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
GUT BuGZ delta GLEBS
Plasmid#84028PurposeExpression of GFP tagged mutant BuGZ in human cellsDepositorInsertBuGZ (ZNF207 Human)
UseLentiviralTagsTurboGFPExpressionMammalianMutationdelta 357−373; Q394RPromoterUCOE / SFFVAvailable sinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp2-a del.SHD
Plasmid#40050DepositorInserthSlp2-a del.SHD (SYTL2 Human)
UseTagsEGFPExpressionMammalianMutationdeletion of SHD domain (1-56)PromoterCMV promoterAvailable sinceNov. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a del.SHD
Plasmid#40036DepositorInserthSlp4-a del.SHD (SYTL4 Human)
UseTagsEGFPExpressionMammalianMutationdeleted SHD domain (1-143)PromoterCMV promoterAvailable sinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only