We narrowed to 2,563 results for: neurod
-
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
GST-FUS ΔNLS 1-513
Plasmid#44984DepositorInsertFUS ΔNLS (1-513aa) (FUS Human)
TagsGSTExpressionBacterialMutationcontains amino acids 1-513PromotertacAvailable SinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-M85E-3XHA
Plasmid#242416PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a M85E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-V82E M85E M92E-3XHA
Plasmid#242418PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with V82E, M85E, and M92E mutations and a 3xHA tag.DepositorInsertCHMP2B (CHMP2B Human)
Tags3xHAExpressionMammalianMutationL4D F5D V82E M85E M92EPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-V82E-3XHA
Plasmid#242393PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a V82E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D,F5D-M92E-3XHA
Plasmid#242417PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a M92E mutation and a 3xHA tag.DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d10-52-3xHA (Δα1)
Plasmid#232004PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the first alpha helix deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d55-96-3xHA (Δα2)
Plasmid#232005PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the second alpha helix deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d97-106-3xHA (Δα2/3 loop)
Plasmid#232006PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the loop connecting the second and third alpha helices deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d106-113-3xHA (Δα3)
Plasmid#232007PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the third alpha helix deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d118-138-3xHA (Δα4)
Plasmid#232008PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the fourth alpha helix deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d55-138-3xHA (Δα2-4)
Plasmid#232009PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the second through fourth helices deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d159-174-3xHA (Δα5)
Plasmid#232010PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the fifth alpha helix deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-d201-213-HA (ΔVPS4 binding)
Plasmid#232011PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with the VPS4-binding region deleted with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235303PurposeLentiviral expression of ComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235304PurposeLentiviral expression of ComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235305PurposeLentiviral expression of ComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-FUS-gRNA
Plasmid#237685PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only