We narrowed to 9,217 results for: sgRNA
-
Plasmid#138347PurposeExpress guide RNA 1 for Dnmt1DepositorInsertmouse Dnmt1 sgRNA (Dnmt1 Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgDnmt1_2
Plasmid#138348PurposeExpress guide RNA 2 for mouse Dnmt1DepositorInsertmouse Dnmt1 sgRNA (Dnmt1 Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable sinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_SRD5A3-mcherry
Plasmid#159782PurposeS. pyogenes sgRNA collocated with pegRNA targeting human SRD5A3 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspacer of sgRNA targeting SRD5A3 gene (SRD5A3 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_HOXD13-mcherry
Plasmid#159793PurposeS. pyogenes sgRNA collocated with pegRNA targeting mouse HOXD13 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspacer of sgRNA targeting HOXD13 gene (HOXD13 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
TagsFRBP12 and Lynn Myristolation siteExpressionMammalianAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDM002-sgRNA-lenti-ZeoR
Plasmid#200060PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sitesDepositorInsertBleomycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available sinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneExpressionMammalianAvailable sinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-SCN8A-SVA-BFP
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only