We narrowed to 13,976 results for: CAN
-
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
PET28-FnCas12a-EP16
Plasmid#183636PurposePET28-FnCas12a-EP16 can efficiently recognize a broad range of PAM sequences including YN (Y = C or T), TAC and CAA.DepositorInsertFnCas12a-EP16
UseCRISPRTags6×His TagExpressionBacterialMutationN607R, K613V, N617R, K180S, K660R, D616NAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-19b-1-5p
Plasmid#103325PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-19b-1-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-19b-1-5p target (MIR19B1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-BAP1-N102S-GFP
Plasmid#78915PurposeMammalian expression of BAP1 with N102S and an EGFP fusionDepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-3-F37A+L196F+V252A+C253G-hADPRM
Plasmid#107163PurposeExpresses specific cyclic-ADP-ribose (cADPR) phosphohydrolase in Escherichia coli as a GST fusion protein that can be cut with PreScission(TM) protease to yield active enzymeDepositorInsertF37A+L196F+V252A+C253G-hADPRM GST-mutant cADPR phosphohydrolase gene
TagsGSTExpressionBacterialPromotertacAvailable SinceMarch 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-522-3p
Plasmid#103614PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-522-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-522-3p target (MIR522 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-183-5p
Plasmid#103285PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-183-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-183-5p target (MIR183 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-483-5p
Plasmid#103551PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-483-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-483-5p target (MIR483 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-3p
Plasmid#103341PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-3p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-193a-3p
Plasmid#103305PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-193a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-193a-3p target (MIR193A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_2
Plasmid#124911PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_3
Plasmid#124913PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-302a-3p
Plasmid#103400PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-302a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-302a-3p target (MIR302A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-885-3p
Plasmid#103744PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-885-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-885-3p target (MIR885 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-579-5p
Plasmid#103661PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-579-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-579-5p target (MIR579 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-510-5p
Plasmid#103593PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-510-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-510-5p target (MIR510 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only