We narrowed to 6,957 results for: crispr cas9 plasmids
-
Plasmid#132440PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ1.1.0-gDNA
Plasmid#132434PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTSHZ1 (TSHZ1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianMutationPromoterTight TRE promoterAvailable sinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianMutationPromoterCMV and U6Available sinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_1
Plasmid#72354PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_2
Plasmid#72355PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorInsertCyr1CT-sgRNA (CYR1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
UseTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)PromoterAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
UseTagsExpressionMutationPromoterU6Available sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPTG-GG-sg2+sg3
Plasmid#127199PurposePlasmid expressing sgRNA2 (TACCACATTTGTAGAGGTT) & sgRNA3 (CAATGTATCTTATCATGTC) as polycistronic tRNA-gRNA from single U6 promoterDepositorInserttRNA-gRNA
UseEmpty sgrna plasmidTagsExpressionMammalianMutationPromoterU6Available sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pELK3.1.0-gDNA
Plasmid#112418PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ELK3DepositorInsertELK3 (ELK3 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pATF4.1.0-gDNA
Plasmid#113772PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ATF4DepositorInsertATF4 (ATF4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJUNB.1.0-gDNA
Plasmid#112409PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor JUNBDepositorInsertJUNB (JUNB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only