We narrowed to 17,879 results for: puromycin
-
Plasmid#225681PurposeConfers puromycin resistance to Salpingoeca rosettaDepositorPublicationInsertpEFL-Pac-Actin_3'UTR
Available sinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRIPZ-NUDT17-C-HA-Puro
Plasmid#195182PurposeLentiviral vector for DOX-inducible NUDT17 gene expression with C-terminal HA tag. Gateway expression system. Selection by puromycin.DepositorInsertNUDT17 (NUDT17 Human)
UseLentiviralTagsHAExpressionMammalianPromoterCMV promoter and minimal CMVAvailable sinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_TP73
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBBi-RP TCS1
Plasmid#139161PurposeSB-transposon with constitutive bi-directional promoter. One side contains tea caffeine synthase 1 (TCS1) from Camellia sinensis; the other side contains RFP and puromycin resistance genes.DepositorInsertCaffeine Synthase 1 [Camellia sinensis]
UseTransposonExpressionMammalianPromoterEF1αAvailabilityAcademic Institutions and Nonprofits only -
pCMV-protein1-IRES-protein2-IRESatt-EGFP-2A-nTermPuroR-nTermIntein
Plasmid#208378PurposeEpisomal plasmid - for expression of 2 proteins linked with EGFP and n-terminal split puromycin resistance and split inteinDepositorTypeEmpty backboneExpressionMammalianPromoterhuman CMVAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPy-CAG-GFP-IRES-Pac
Plasmid#48759PurposeCAG promoter driving GFP-IRES-Puromycin Acetyl TransferaseDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP
UsePpyExpressionMammalianPromoterCAGAvailable sinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR_SFFV*/Puro2a-PAG1-GFP
Plasmid#198223PurposeLentiviral plasmid derived from pHR_SFFV (Addgene #79121) expressing cDNA for a codon-optimized puromycin resistance gene, followed by an FMDV 2A domain and then EGFPDepositorInsertPAG1 (PAG1 Human)
UseLentiviralTagsFollowed by EGFP, after a flexible linker and Pre…ExpressionMammalianMutationNoneAvailable sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBBi-RP CCS1(Δ304-316)
Plasmid#139163PurposeSB-transposon with constitutive bi-directional promoter. One side contains coffee caffeine synthase 1 (CCS1) CCS-CTS deletion mutant; the other side contains RFP and puromycin resistance genes.DepositorInsertcaffeine synthase 1 [Coffea arabica] CCS-CTS region deletion
UseTransposonExpressionMammalianMutationdeleted amino acids 304-319PromoterEF1αAvailabilityAcademic Institutions and Nonprofits only -
pSBBi-RP GST-CCS1
Plasmid#139164PurposeSB-transposon with constitutive bi-directional promoter. One side contains N-GST coffee caffeine synthase 1 (GST-CCS1) fusion; the other side contains RFP and puromycin resistance genes.DepositorInsertglutathione transferase + caffeine synthase 1 [Coffea arabica]
UseTransposonTagsGlutathione transferaseExpressionMammalianPromoterEF1αAvailabilityAcademic Institutions and Nonprofits only -
pGL3-kLANA-puro
Plasmid#131699Purposeexpresses the KHSV LANA promoter driving puromycin resistanceDepositorPublicationInsertLANA promoter
ExpressionMammalianPromoterLANAAvailable sinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_gRNA_S.pyogenes_scaffold_BB
Plasmid#226429PurposePiggyBac transposon vector backbone for cloning of sgRNA compatible with S.pyogenes dCas9 enzyme. BbsI Golden Gate site upstream of the scaffold for protospacer insertion. Puromycin selection marker.DepositorTypeEmpty backboneUseCRISPR; Piggybac transposonExpressionMammalianPromoterU6Available sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDH-EF1-Mito-pHCountdown
Plasmid#182302Purposelentiviral plasmid encoding pH-Countdown targeted to mitochondria via fusion to the COX8A presequence with puromycin selectionDepositorPublicationInsertmito pH countdown
UseLentiviralTagsCOX8A mitochondria targeting sequencePromoterEF-1aAvailable sinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM60 FLAG-RAB35 S22N
Plasmid#107106PurposeLentiviral vector that codes for FLAG-RAB35 S22N (human) protein. Puromycin resistance for mammalian selection and ampicillin resistance for growth in Stbl3 cells.DepositorAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-tetO-CTR1-shRNA
Plasmid#53180PurposeExpresses shRNA against human CTR1 from puromycin resistance retroviral vectorDepositorAvailable sinceSept. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
hgRNA-A21_pLKO-Puro
Plasmid#100570PurposehgRNA-A21 in a lentiviral backbone with puromycin resistanceDepositorInserthgRNA-A21
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRB33
Plasmid#72867Purposetemplate for N-terminal 3x FLAG tag, constitutive Puromycin resistanceDepositorInsert3xFlag tag
ExpressionInsectAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSK25
Plasmid#72853Purposetemplate for C-terminal double-FLAG tag, Puromycin-resistanceDepositorInsertdouble Flag
ExpressionInsectAvailable sinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-CMVSP6-nEGFP-SV40-PURO
Plasmid#138364PurposeLentiviral plasmid for nuclear EGFP expression driven by CMVSP6 and puromycin resistance under SV40 promoter for selectionDepositorInsertnuclear EGFP
UseLentiviralExpressionMammalianAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV-sgTel
Plasmid#122659PurposeExpresses sgRNA for telomere repeats with fluorescent indicator BFP and puromycin selection markerDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by