We narrowed to 4,082 results for: Gaa
-
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs7903146-guide3
Plasmid#118200PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs7903146 (TCF7L2 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs11257655-guide4
Plasmid#118203PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs11257655 (CDC123/CAMK1D GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs11257655-guide3
Plasmid#118202PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs11257655 (CDC123/CAMK1D GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CAMK1D TSS-guide4
Plasmid#118180PurposeCRISPR-mediated repression of CAMK1D. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR OPTN TSS-guide3
Plasmid#118183PurposeCRISPR-mediated repression of OPTN. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide4
Plasmid#118176PurposeCRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
CDK11B gRNA (BRDN0001146757)
Plasmid#77064Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TGFBR1 gRNA (BRDN0001146778)
Plasmid#76644Purpose3rd generation lentiviral gRNA plasmid targeting human TGFBR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1 gRNA (BRDN0001146284)
Plasmid#75539Purpose3rd generation lentiviral gRNA plasmid targeting human NME1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
23SrRNA.RAV12(wt).2508-2580.G2530AAAC
Plasmid#26190DepositorInsert23S ribosomal RNA fragment (modified)
ExpressionBacterialMutationfragment 2508-2580 of E. coli rRNA, with nucleoti…Available SinceOct. 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
huCof S3E SSR RedTrack
Plasmid#245953PurposeExpression of inactive (phosphomimetic) cofilin S3E resistant to shRNA in cells coexpressing mRFPDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3E + silent mutations (NTs 67 to 75) in which TC…PromoterCMV for huCof S3E and separate CMV for mRFPAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof S3A SSR RedTrack
Plasmid#245956PurposeExpression of constitutively active cofilin S3A resistant to shRNA in cells coexpressing mRFPDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3A + silent mutations (NTs 67 to 75) in which TC…PromoterCMV for huCof S3A and separate CMV for mRFPAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced-MUT- deltaACAbox
Plasmid#242753PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1-unspliced-MUT- deltaHbox
Plasmid#242752PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Puro-CMV-EPB41L4A-AS1 unspliced-MUT- deltaSNORA13
Plasmid#242751PurposeExpresses unspliced EPB41L4A-AS1 in mammalian cellsDepositorInsertEPB41L4A-AS1 (EPB41L4A-AS1 Human)
UseLentiviralExpressionMammalianMutationAACTTAAAAGCAGCGT → ACCTTAGAAGTAGAGT making it res…PromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA938 - pBA904 Puro-T2A-GFP PLAGL1_g1 CRISPRa guide guide (pRCA360 backbone)
Plasmid#238189PurposeLentiviral CRISPR guide vector expressing a PLAGL1 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA803 - pBA904 Puro-T2A-GFP KLF5 g1 CRISPRa guide (pRCA360 backbone) 666
Plasmid#238172PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA804 - pBA904 Puro-T2A-GFP KLF5 g2 CRISPRa guide (pRCA360 backbone) 665
Plasmid#238173PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
KU70-eGFP-SUN1ΔN
Plasmid#213516PurposeExpresses human KU70-eGFP-SUN1ΔN in mammalian cellsDepositorInsertKU70-eGFP-SUNΔN
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NR5A2_5-5)-PGKpuroBFP-W
Plasmid#211977PurposeExpress gRNA against NR5A2 with puro and BFPDepositorInsertsgRNA targeting NR5A2 (NR5A2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-12
Plasmid#129064Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA12 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA12 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SgmouseTSDR-2
Plasmid#129054Purposetargeted DNA demethylation_mouse_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA2 targeting mouse TSDRDepositorInsertdCas9-huTET1CD, SgRNA2 (mouseTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-2
Plasmid#129030Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA2 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA2 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only