We narrowed to 71,582 results for: kan
-
Plasmid#128467Purposedestination vector with N-terminal V5 tagDepositorInsertdestination vector with N-terminal V5 tag
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
S2_AscI_HA-gateway_Bsu36I
Plasmid#128468Purposedestination vector with N-terminal HA tagDepositorInsertdestination vector with N-terminal HA tag
ExpressionBacterialAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
rEc2
Bacterial Strain#51946PurposeoriT-kan templateDepositorBacterial ResistanceKanamycinAvailable SinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
UQ6139
Bacterial Strain#37177DepositorBacterial ResistanceAmpicillin and KanamycinSpeciesBurkholderia xenovoransAvailable SinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas3
Plasmid#178881PurposeExpression of human codon-optimized NlaCas3 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas3c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHC01
Plasmid#106900PurposeRatiometric gas biosensor plasmid for 3-oxo-C12-HSL sensingDepositorInsertsLasR
Methyl Halide Transferase
Ethylene Forming Enzyme
Red Fluorescent Protein
ExpressionBacterialAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDuRCC-K
Plasmid#81193PurposeExpression of Cas9 and two gRNA cassettes in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below., Please view…PromoterROX3 and SNP52pAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRelA'
Plasmid#175595PurposeTet inducible, KAN Resistant, non labelled synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
ExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKEE401
Plasmid#91715PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas5
Plasmid#178878PurposeExpression of human codon-optimized Nlacas5 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas5c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas8
Plasmid#178880PurposeExpression of human codon-optimized NlaCas8 with N terminal NLS and HA tagDepositorInsertEF1a-NlaCas8c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas11
Plasmid#178882PurposeExpression of human codon-optimized NlaCas11 with N terminal NLS and HA tagDepositorInsertEF1a-NlaCas11c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas7
Plasmid#178879PurposeExpression of human codon-optimized Nlacas7 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas7c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICH67131
Plasmid#153223PurposeLevel 1 position 1 containing the Nos promoter, NPTII (Kan resistance), and the Nos terminatorDepositorInsertNos promoter, NPTII, Nos terminator
UseSynthetic BiologyAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-eGFP-NT1-6-gix-6-NT1
Plasmid#81204Purposecontains two target sites consisting of PAM-NT1-6bp-gix psuedo site-6bp-NT1-PAM flanking a kan/pA as previously described in the pCALNL-eGFP plasmidDepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-APEX2-mCherry
Plasmid#188944PurposeMiddle entry vector for Gateway cloning containing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherryDepositorInsertmito-APEX2_p2A_APEX2-H2B_p2A_mCherry
UseMiddle entry vector for gateway (l1-l2)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBER
Plasmid#62662PurposeDonor vector for tdTomato knock-in via landing padDepositorInsertstdTomato
hygromycin
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGX
Plasmid#62666PurposeDonor vector for Dre knock-in via landing padDepositorInsertDre
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGO
Plasmid#62671PurposeDonor vector for mFTH1 knock-in via landing padDepositorInsertFTH1
UseCre/LoxTagsHAExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only