We narrowed to 9,178 results for: mel
-
Plasmid#39750DepositorAvailable SinceSept. 19, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-Oskar 139-240 MUT (A162E/L228E) (HK202)
Plasmid#206464PurposeOskar 139-240 mut expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MCAM-BirA*-HA
Plasmid#214472PurposeLentiviral vector for the expression of MCAM-BirA*-HA fusion protein in mammalian cells.DepositorInsertMCAM (MCAM Human)
UseLentiviral; GatewayTagsBirA(R118G) and HA tagExpressionMammalianPromoterEF-1aAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam_AG
Plasmid#148831PurposeBacterial Expression of DmBamDepositorInsertDmBam (bam Fly)
ExpressionBacterialMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam-del13-36_AG
Plasmid#148834PurposeBacterial Expression of DmBam-del13-36DepositorInsertDmBam-del13-36 (bam Fly)
ExpressionBacterialMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam-L17E_AG
Plasmid#148835PurposeBacterial Expression of DmBam-L17EDepositorInsertDmBam-L17E (bam Fly)
ExpressionBacterialMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvM-DmBam-M24E_AG
Plasmid#148836PurposeBacterial Expression of DmBam-M24EDepositorInsertDmBam-M24E (bam Fly)
ExpressionBacterialMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmBam_141-422_AG
Plasmid#148816PurposeInsect Expression of DmBam_141-422DepositorInsertDmBam_141-422 (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmBam-L17EM24EL28EV32E_AG
Plasmid#148817PurposeInsect Expression of DmBam-L17EM24EL28EV32EDepositorInsertDmBam-L17EM24EL28EV32E (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmBam-L17EM24EL28EV32E_AG
Plasmid#148819PurposeInsect Expression of DmBam-L17EM24EL28EV32EDepositorInsertDmBam-L17EM24EL28EV32E (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmBam_141-422_AG
Plasmid#148821PurposeInsect Expression of DmBam_141-422DepositorInsertDmBam_141-422 (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmBam-del13-36_AG
Plasmid#148822PurposeInsect Expression of DmBam-del13-36DepositorInsertDmBam-del13-36 (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmBam-L17E_AG
Plasmid#148823PurposeInsect Expression of DmBam-L17EDepositorInsertDmBam-L17E (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmBam-L28E_AG
Plasmid#148824PurposeInsect Expression of DmBam-L28EDepositorInsertDmBam-L28E (bam Fly)
ExpressionInsectMutationone non silent mutation A239 to S, described as …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only