We narrowed to 15,882 results for: gRNA
-
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantMutationPromoterArabidopsis U6 promoterAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- PRDM1.bs- ZEB2.locus (PRDM1 Human)
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPExpressionMutationPromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA4
Plasmid#164934PurposeExpresses EGFP sgRNA4 in mammalian cellsDepositorInsertsgRNA4 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralTagsExpressionMutationPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDR274-gsc2-sgRNA
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisTagsExpressionMutationPromoterAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianMutationPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 1
Plasmid#207607PurposesgRNA for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertcgactcgcccggcagcgcac
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2702-AGER-gRNA1
Plasmid#216471Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2704-AGER-gRNA3
Plasmid#216473Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xMS2 TR knockin sgRNA 2
Plasmid#207608PurposesgRNA 2 for homology directed repair insertion of 3xMS2-TR-100-PURO into the endogenous TR locusDepositorInsertacccccaaacctgactgact
UseTagsNoneExpressionMammalianMutationPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only