We narrowed to 378 results for: TP53
-
Plasmid#228929PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i3 (Trp53 Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P2-p53 (1-90) (72R)
Plasmid#62081PurposeExpression of human p53 (TAD residues 1-90) (72R) in e. coliDepositorInsertp53 (TP53 Human)
TagsGSTExpressionBacterialMutationContains TAD/PP residues 1-90, 72RPromotertacAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R/K164R)
Plasmid#72556PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R/K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120R/K164RPromoterE1B minimal promoterAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-p53 (1-90) (72P)
Plasmid#62080PurposeExpression of human p53 (1-90) (72P) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationcontains TAD/PP residues 1-90; 72PPromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
phBG-P53DD
Plasmid#149707PurposeIn vitro transcription of dominant negative form of P53 mRNA for RNA transfection into mammalian cellsDepositorAvailable SinceJune 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P12A P13A)
Plasmid#62066PurposeExpression of human p53 (residues 1-73) (P12A, P13A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P12A, P13APromoterT7Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P to A)
Plasmid#62069PurposeExpression of human p53 (1-73) (all P to A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; all Prolines changed …PromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P27A)
Plasmid#62068PurposeExpression of human p53 (1-73) (P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P27APromoterT7Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-p53DD-IRES-HRAS(G12V)
Plasmid#233188PurposeGateway entry vector for p53DD and HRAS(G12V) (DDIR)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (PPP)
Plasmid#62067PurposeExpression of human p53 (1-73) (P12A, P13A, P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P12A, P13A, P27APromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SNAP-p53DD-IRES-HRAS(G12V)-bGH
Plasmid#233204PurposeAAV expression of SNAP-p53DD and HRAS(G12V)DepositorUseAAVExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53
Plasmid#196267PurposeMammalian expression of 3xHA tagged wild-type p53DepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HRAS(G12V)-IRES-SNAP-p53DD
Plasmid#233200PurposeRetroviral expression of HRAS(G12V) and SNAP-p53DDDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-SNAP-p53DD-IRES-HRAS(G12V)
Plasmid#233198PurposeRetroviral expression of SNAP-p53DD and HRAS(G12V)DepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53 Δ1-42
Plasmid#196269PurposeMammalian expression of 3xHA tagged p53 Δ1-42 (ΔTAD1)DepositorInsertp53 Δ1-42 (Trp53 Mouse)
Tags3xHAExpressionMammalianMutationdeleted amino acids 1 to 42PromoterCMVAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HRAS(G12V)-IRES-p53DD
Plasmid#233185PurposeRetroviral expression of HRAS(G12V) and p53DD (RIDD)DepositorUseRetroviralExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only