We narrowed to 1,324 results for: G3
-
Plasmid#119015PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV689
Plasmid#119016PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSM08
Plasmid#139042PurposeMosSCI SapTrap assembly: Cassette 3 for 4-cassette systemDepositorInsertmscarlet (includes STOP codon)
ExpressionWormAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-TID-HA3-HIS3MX6
Plasmid#227981PurposeTo insert biotin ligase, TurboID, at the C-terminus of genes; yeast BioID, HIS3MX6 markerDepositorInsertTurboID
TagsHA tagExpressionYeastAvailable SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFJ782 - HygroR
Plasmid#190933PurposeHygromycin resistance co-injection markerDepositorInsertHygromycin resistance gene
ExpressionWormPromoterrps-0Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS012
Plasmid#188335PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mTagBFP2::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS011
Plasmid#188334PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mTagBFP2::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFa6-TID-FKBP-3HA-HIS3MX6
Plasmid#228025PurposeTo integrate TID-FKBP fusion at yeast promoter; yeast BioID with HIS3MX6 markerDepositorInsertTurboID-FKBP
TagsHA tagExpressionYeastAvailable SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-his6-HA3-SNAPf
Plasmid#188941PurposeT7 expression vector for making his6- and HA3-tagged SNAP proteinDepositorInserthis6-HA3-SNAPf
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-his6-HA3-HALO
Plasmid#188943PurposeT7 expression vector for making his6- and HA3-tagged HALO proteinDepositorInserthis6-HA3-HALO
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJS006
Plasmid#188329PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mNeonGreen::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB4695
Plasmid#171127PurposeA plasmid containing the codon-optimized OsTIR1-F74A, which is under the control of adh1 promoter. It served as one of the F-box protein expression plasmids in AID system.DepositorInsertOsTIR1-F74A
UseOtherMutationnon applicableAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB5050
Plasmid#171126PurposeA plasmid containing the codon-optimized OsTIR1, which is under the control of adh1 promoter. It served as one of the F-box protein expression plasmids in AID system.DepositorInsertOsTIR1
UseOtherMutationnon applicableAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJF5
Plasmid#139031PurposeMosSCI SapTrap assembly: Cassette 2 for 4- or 5-cassette systemDepositorInsertgfp (no STOP codon, PATC introns)
ExpressionWormAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-mTID-HA3-HIS3MX6
Plasmid#227983PurposeTo insert biotin ligase, miniTurboID, at the C-terminus of genes; yeast BioID,HIS3MX6 markerDepositorInsertminiTurboID
TagsHA tagExpressionYeastAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJS002
Plasmid#188325PurposePCR template for repair templates to tag a gene with a GFP and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::GFP::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSM10
Plasmid#139034PurposeMosSCI SapTrap assembly: Cassette 2 for 4- or 5-cassette systemDepositorInsertmScarlet (no STOP codon)
ExpressionWormAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBK28 pHomL-TDH3p-GFPdropout-Link-Neon(gfp)-SSA1t-HomR (AmpR)
Plasmid#179012PurposeParent vector for markerless yeast integration cassettes with C-terminal Neon(gfp)-tagged genesDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only