We narrowed to 4,733 results for: Gca
-
Plasmid#78051Purpose3rd generation lentiviral gRNA plasmid targeting human MST1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TNNI3K gRNA (BRDN0001487146)
Plasmid#77896Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVRL1 gRNA (BRDN0001147295)
Plasmid#77780Purpose3rd generation lentiviral gRNA plasmid targeting human ACVRL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACVRL1 gRNA (BRDN0001149122)
Plasmid#77782Purpose3rd generation lentiviral gRNA plasmid targeting human ACVRL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
KALRN gRNA (BRDN0001146234)
Plasmid#77637Purpose3rd generation lentiviral gRNA plasmid targeting human KALRNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2B gRNA (BRDN0001146901)
Plasmid#77398Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK2B gRNA (BRDN0001147766)
Plasmid#77400Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PNCK gRNA (BRDN0001148324)
Plasmid#77329Purpose3rd generation lentiviral gRNA plasmid targeting human PNCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TK2 gRNA (BRDN0001144837)
Plasmid#77297Purpose3rd generation lentiviral gRNA plasmid targeting human TK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IPPK gRNA (BRDN0001148440)
Plasmid#77154Purpose3rd generation lentiviral gRNA plasmid targeting human IPPKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3CG gRNA (BRDN0001147429)
Plasmid#76333Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CGDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN1 gRNA (BRDN0001149250)
Plasmid#76275Purpose3rd generation lentiviral gRNA plasmid targeting human PKN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RP2 gRNA (BRDN0001145706)
Plasmid#76285Purpose3rd generation lentiviral gRNA plasmid targeting human RP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRPS1 gRNA (BRDN0001147960)
Plasmid#76199Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKCB gRNA (BRDN0001145137)
Plasmid#75956Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BUB1B gRNA (BRDN0001148077)
Plasmid#75918Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FPGT-TNNI3K gRNA (BRDN0001147862)
Plasmid#75903Purpose3rd generation lentiviral gRNA plasmid targeting human FPGT-TNNI3KDepositorInsertFPGT-TNNI3K,TNNI3K (FPGT-TNNI3K Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
C8orf44-SGK3 gRNA (BRDN0001146567)
Plasmid#75906Purpose3rd generation lentiviral gRNA plasmid targeting human C8orf44-SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLT4 gRNA (BRDN0001147158)
Plasmid#75629Purpose3rd generation lentiviral gRNA plasmid targeting human FLT4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLT4 gRNA (BRDN0001147213)
Plasmid#75630Purpose3rd generation lentiviral gRNA plasmid targeting human FLT4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75247PurposeCRISPR/Cas9 NICKASE plasmid against human Helios (2/2)DepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-31-192-193a-Reporter
Plasmid#71874PurposeMammalian expression vector for the analysis of miR-31-19α-193a activityDepositorInsertBinding sequence targeted by miR-31, miR192, and miR-193a-5p
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IARS2-tb
Plasmid#232340PurposeExpresses human IARS2 with synonymous mutations (to prevent recognition by siRNA) in mammalian cellsDepositorInsertIARS2 (IARS2 Human)
ExpressionMammalianMutation5 synonymous mutations in the siRNA (ACUUGCAGUCAU…PromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-SpRY C aa714-1368-U6-Camk2d sgRNA
Plasmid#209788PurposeExpresses SpRY cas9C by the constitutive CASI promoter and sgRNA targeting the oxidative activation sites of Camk2d by U6 promoterDepositorInsertSpRY C, Camk2d sgRNA
UseAAVPromoterCASIAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TRIM25_5-2)-PGKpuroBFP-W
Plasmid#211990PurposeExpress gRNA against TRIM25 with puro and BFPDepositorInsertsgRNA targeting TRIM25 (TRIM25 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TRIM25_v3_6-4)-PGKpuroBFP-W
Plasmid#211991PurposeExpress gRNA against TRIM25 with puro and BFPDepositorInsertsgRNA targeting TRIM25 (TRIM25 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MYC_7)-PGKpuroBFP-W
Plasmid#211971PurposeExpress gRNA against MYC with puro and BFPDepositorInsertsgRNA targeting MYC (MYC Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETV4_5-1)-PGKpuroBFP-W
Plasmid#211960PurposeExpress gRNA against ETV4 with puro and BFPDepositorInsertsgRNA targeting ETV4 (ETV4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETV4_5-2)-PGKpuroBFP-W
Plasmid#211961PurposeExpress gRNA against ETV4 with puro and BFPDepositorInsertsgRNA targeting ETV4 (ETV4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only