We narrowed to 10,670 results for: nar
-
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantMutationPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-FOXC1-T2A-miRFP670
Plasmid#182336PurposeExpresses human FOXC1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertForkhead Box C1 (FOXC1 Human)
UseTagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianMutationPromoterCMVAvailable sinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 N-T2A-M-IRES-E
Plasmid#231903PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '3-plasmid' systemDepositorUseTagsExpressionMammalianMutationR203M in N proteinPromoterCMVAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K20-P2A-mCherry
Plasmid#185618PurposeRibosomal stalling reporter: positive controlDepositorInsertGFP-K20(AAA)-mCherry
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-K0-P2A-mCherry
Plasmid#185619PurposeRibosomal stalling reporter: emptyDepositorInsertGFP-empty-mCherry
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-CMV-GFP-P2A-I15-P2A-mCherry
Plasmid#185620PurposeRibosomal stalling reporter: 15x isoleucineDepositorInsertGFP-I15-mCherry
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A1.1-GFP (pc2188)
Plasmid#223707PurposeExpression of macroH2A1.1 tagged N-terminal to GFPDepositorInsertmacroH2A1.1-GFP (Macroh2a1 Rat)
UseTagsGFPExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A1.2-GFP (pc2189)
Plasmid#223708PurposeExpression of macroH2A1.2 tagged N-terminal to GFPDepositorInsertmacroH2A1.2-GFP (Macroh2a1 Rat)
UseTagsGFPExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR051
Plasmid#185029Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-51 and 80-84 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationNucleotides 47-51 & 80-84 mutated rpmE 5'…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR052
Plasmid#185030Purpose400 nt l31 promoter region, l31 5'UTR with nt. 56-61 and 68-73 mutated, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationNucleotides 56-61 and 68-73 mutated in rpmE 5…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR104
Plasmid#185034Purpose400 nt l31 promoter region, l31 5'UTR A74 and A76 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationA74 and A76 deletion of rpmE 5'UTR, Only fir…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR105
Plasmid#185035Purpose400 nt l31 promoter region, l31 5'UTR G52 and G79 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationG52 and G79 deletion of rpmE 5'UTR, Only fir…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR107
Plasmid#185037Purpose400 nt l31 promoter region, l31 5'UTR AGA74-76GAG mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationAGA74-76GAG mutation of rpmE 5'UTR, Only fir…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR109
Plasmid#185038Purpose400 nt l31 promoter region, l31 5'UTR G60 and C69 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationG60 and C69 deletion of rpmE 5'UTR, Only fir…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR110
Plasmid#185039Purpose400 nt l31 promoter region, l31 5'UTR G62 and G67 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationG62 and G67 deletion of rpmE 5'UTR, Only fir…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR039
Plasmid#185025Purpose400 nt l31 promoter region, l31 5'UTR with nt. 1-31 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationNucleotides 1-31 deleted from rpmE 5'UTR, On…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR040
Plasmid#185026Purpose400 nt l31 promoter region, l31 5'UTR with nt. 35-46 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationNucleotides 35-46 deleted from rpmE 5'UTR, O…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR041
Plasmid#185027Purpose400 nt l31 promoter region, l31 5'UTR with nt. 47-54 & 76-86 deleted, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
UseTagsExpressionBacterialMutationNucleotides 47-54 & 76-86 deleted from rpmE …PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only