We narrowed to 11,308 results for: ena
-
Plasmid#146069PurposeInsect Expression of DmTral-LSm-F44ADepositorInsertDmTral-LSm-F44A (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-K73AD74A-V5His6_C
Plasmid#146070PurposeInsect Expression of DmTral-LSm-K73AD74ADepositorInsertDmTral-LSm-K73AD74A (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R21EE23KS13AI15A-V5His6_C
Plasmid#146072PurposeInsect Expression of DmTral-LSm-R21EE23KS13AI15ADepositorInsertDmTral-LSm-R21EE23KS13AI15A (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-D30KT35A_C
Plasmid#146042PurposeInsect Expression of DmTral-D30KT35ADepositorInsertDmTral-D30KT35A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-del46-60_C
Plasmid#146043PurposeInsect Expression of DmTral-del46-60DepositorInsertDmTral-del46-60 (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-F44A_C
Plasmid#146044PurposeInsect Expression of DmTral-F44ADepositorInsertDmTral-F44A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-K73AD74A_C
Plasmid#146045PurposeInsect Expression of DmTral-K73AD74ADepositorInsertDmTral-K73AD74A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R42E_B
Plasmid#145988PurposeInsect Expression of DmTral-R42EDepositorInsertDmTral-R42E (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_BACH1_Y11A
Plasmid#159131PurposeExpresses BACH1 in mammalian cellsDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
ExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g1)-PGKpuroBFP-W
Plasmid#105028PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g2)-PGKpuroBFP-W
Plasmid#105029PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g1)-PGKpuroBFP-W
Plasmid#105035PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Kcmf1-g1)-PGKpuroBFP-W
Plasmid#105017PurposeLentiviral gRNA plasmid targeting mouse Kcmf1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-27a-5p
Plasmid#103382PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-27a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-27a-5p target (MIR27A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-2-3p
Plasmid#103414PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-2-3p target (MIR30C2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-96-3p
Plasmid#103760PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-96-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-98-3p
Plasmid#103762PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-98-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-98-5p
Plasmid#103763PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-98-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-99b-3p
Plasmid#103766PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-99b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-99b-3p target (MIR99B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-876-5p
Plasmid#103743PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-876-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-876-5p target (MIR876 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-887-3p
Plasmid#103746PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-887-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-887-3p target (MIR887 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-887-5p
Plasmid#103747PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-887-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-887-5p target (MIR887 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-92a-2-5p
Plasmid#103751PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-92a-2-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-92a-2-5p target (MIR92A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-93-5p
Plasmid#103756PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-93-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-802
Plasmid#103737PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-802 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-657
Plasmid#103712PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-657 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-659-3p
Plasmid#103713PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-659-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-659-3p target (MIR659 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-671-5p
Plasmid#103719PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-671-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-671-5p target (MIR671 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-675-3p
Plasmid#103720PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-675-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-675-3p target (MIR675 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-708-3p
Plasmid#103724PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-708-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-708-3p target (MIR708 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-708-5p
Plasmid#103725PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-708-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-708-5p target (MIR708 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-634
Plasmid#103692PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-634 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-635
Plasmid#103693PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-635 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-640
Plasmid#103695PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-640 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-645
Plasmid#103699PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-645 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-648
Plasmid#103700PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-648 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only