We narrowed to 14,613 results for: NSI
-
Plasmid#226551PurposeBacterial expression of N-terminally 6His tagged A1-LCD X9DepositorInsertA1-LCD swap X9
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X8
Plasmid#226550PurposeBacterial expression of N-terminally 6His tagged A1-LCD X8DepositorInsertA1-LCD swap X8
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X6
Plasmid#226548PurposeBacterial expression of N-terminally 6His tagged A1-LCD X6DepositorInsertA1-LCD swap X6
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap X2
Plasmid#226544PurposeBacterial expression of N-terminally 6His tagged A1-LCD X2DepositorInsertA1-LCD swap X2
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB67
Plasmid#226316PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with K to A CsoS2 MR1-6
ExpressionBacterialMutationK261A, K320A, K380A, K436A, K495A, K546APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB68
Plasmid#226315PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-7
ExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534A, Y585A, Y644APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB74
Plasmid#226314PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-5
ExpressionBacterialMutationY300A, Y359A, Y420A, Y475A, Y534APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB73
Plasmid#226313PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with Y to A CsoS2 MR1-3
ExpressionBacterialMutationY300A, Y359A, Y420APromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB51
Plasmid#226308PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1
ExpressionBacterialMutationVTG273-275AAA, VTG284-286AAA, VTG295-297AAAPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB48
Plasmid#226307PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-6
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB47
Plasmid#226306PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-5
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485S, C526S, …PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB46
Plasmid#226305PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-4
ExpressionBacterialMutationC292S, C310S, C351S, C369S, C467S, C485SPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB45
Plasmid#226304PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with C to S CsoS2 MR1-2
ExpressionBacterialMutationC292S, C310S, C351S, C369SPromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
POSV801-SP44-SnaABCDEOinT1T2
Plasmid#225058PurposeHeterologous expression in Streptomyces with inactive SnaODepositorInsertinactivated SnaO
ExpressionBacterialMutationdeltaR51-V511PromoterSP44Available SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
POSV801-SP44-SnaABCDEOT1T2
Plasmid#225055PurposeHeterologous expression in Streptomyces for threopeptin biosynthetic gene clusterDepositorInsertSnaA
ExpressionBacterialMutationWTPromoterSP44Available SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5417_p3WJdB_promoter dropout vector
Plasmid#221191PurposePromoter probe vector with dropout sequence for promoter sequences with 3WJdB reporterDepositorTypeEmpty backboneUseSynthetic BiologyPromoterPromoter Placeholder/Dropout VectorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaM
Plasmid#224428PurposeExpress AzaM in E. coliDepositorInsertazaM
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaC
Plasmid#224424PurposeExpress AzaC in E. coliDepositorInsertazaC
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaD
Plasmid#224425PurposeExpress AzaD in E. coliDepositorInsertazaD
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaB
Plasmid#224423PurposeExpress AzaB in E. coliDepositorInsertazaB
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaG
Plasmid#224427PurposeExpress AzaG in E. coliDepositorInsertazaG
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AzaE
Plasmid#224426PurposeExpress AzaE in E. coliDepositorInsertazaE
TagsHis6ExpressionBacterialAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Vector 1174K
Plasmid#221017PurposeFluorescent based sex separator in Anopheles species mosquitoes (SEPARATOR)DepositorInsertEngineered dobulesex splicing module (Anopheles gambiae)
UseSynthetic BiologyExpressionInsectAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(EP)-blast-mNG
Plasmid#221051PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(VSG)-blast-mNG
Plasmid#221050PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVEX2.3-AC17-5c-frGFP
Plasmid#217525PurposeAC17-5c riboswitch-regulated GFP reporter. The gene is inserted into downstream of T7 promoter.DepositorInsertAC17-5c riboswitch-regulated folding reporter GFP
UseIn vitro transcription-translationPromoterT7Available SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGWB602-po-mCerulean
Plasmid#213861PurposeBinary vector for the expression of peroxisome transit peptide fused mCerulean in plants (for Agrobacterium-mediated genetic transformation and visualization of peroxisome.)DepositorInsertPeroxisome transit peptide fused mCerulean
ExpressionBacterial and PlantAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK201
Plasmid#207131PurposeType 2 ptac promoter partDepositorInsertptac promoter
ExpressionBacterialAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIwt-PRM-Wasabi
Plasmid#195553PurposeAlways-on expression of mWasabi reporter with transcription activation by wildtype CIDepositorInsertsmWasabi
CIwt
Tags6x His and AANDENYADAS degradation tagExpressionBacterialAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
IL1_1
Plasmid#207623PurposeLow copy plasmid expressing mTurquoise2 under the TDH3p promoterDepositorInsertmTurquoise2
ExpressionYeastPromoterScTDH3Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_Caspase-11_humanized-mutant
Plasmid#214315PurposeProtein overexpression in bacteriaDepositorInsertCASP4 (Casp4 Mouse)
TagsHis-TEVExpressionBacterialMutationN152K_KLS288YKT_KASIHS348TPRAKAPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Caspase-11_rat_catalytic domain
Plasmid#214329PurposeProtein overexpression in bacteriaDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_Caspase-4_W267N
Plasmid#214314PurposeProtein overexpression in bacteriaDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_Caspase-4_R269D
Plasmid#214313PurposeProtein overexpression in bacteriaDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Pro-IL-18_lemur
Plasmid#214332PurposeProtein overexpression in bacteriaDepositorInsertIL18
TagsHis-TEV and MycExpressionBacterialPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Caspase-4_lemur_catalytic domain
Plasmid#214328PurposeProtein overexpression in bacteriaDepositorInsertCASP4
TagsHis-TEVExpressionBacterialPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC13
Plasmid#197407PurposeHoney bee gut symbiont broad-host range vector with constitutive GFP, ampR and pVS1 repliconDepositorInsertpVS1 replicon
UseSynthetic BiologyAvailable SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC23
Plasmid#197409PurposeHoney bee gut symbiont broad-host range vector with constitutive E2-crimson, ampR and pBBR1 repliconDepositorInsertpBBR1 replicon
UseSynthetic BiologyAvailable SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only