We narrowed to 28,225 results for: STI;
-
Plasmid#103227PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-135a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-135a-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1
Plasmid#103160PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1 target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
mARGAna (cassette 1, transient)
Plasmid#197588PurposeSecond-generation mammalian acoustic reporter gene derived from AnabaenaDepositorInsertmARGAna (cassette 1)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311 ETV4-S
Plasmid#74983PurposeConstitutive ETV4 ORF, blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-192-3p
Plasmid#103303PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-192-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-192-3p target (MIR192 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-192-5p
Plasmid#103304PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-192-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-192-5p target (MIR192 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-CKS1
Plasmid#177013PurposeGenerate baculovirus for insect cell expression of CKS1 with N-terminal Polyhistidine-TEVDepositorInsertCKS1 (CKS1B Synthetic, Human)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr-mKO-MK2
Plasmid#115492PurposeExpression vector for the p38 activity reporter mKO-MK2 in mammalian cellsDepositorInsertmKO-MK2 (MAPKAPK2 Human)
Tagsmonomeric Kusabira Orange (mKO)ExpressionMammalianPromoterCAGAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVAX1-cGAS
Plasmid#196624PurposeExpress mouse cGAS protein in mammalian cells.DepositorAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only