We narrowed to 16,004 results for: sgRNA
-
Plasmid#238178PurposeLentiviral CRISPR guide vector expressing a ZNF296 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
p213-SWITCH-OFF
Plasmid#217888PurposeRetroviral Switch-OFF vector for sgRNA expression; U6-BbsIx2-SWITCH-OFF-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
p204-U6-Switch-ON
Plasmid#217883PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-ZNF746
Plasmid#207822PurposeDual expression of Cas9 and sgRNA targeting ZNF746DepositorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_COX4
Plasmid#177983Purposelentiviral vector expressing Cas9 and a sgRNA targeting COX4DepositorInsertsgRNA targeting COX4
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-ttn.1_C3
Plasmid#140866PurposesgRNA synthesis vector for ttn.1_C3 (zebrafish titin .1).DepositorInsertzebrafish ttn.1_C3 sgRNA for in vitro transcription (ttn.1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO1_AH
Plasmid#148854PurposeMammalian Expression of HsAGO1-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYTK050
Plasmid#65157PurposeEncodes sgRNA Dropout as a Type 234 part to be used in the Dueber YTK systemDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2292
Plasmid#70707PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 2: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2253
Plasmid#70704PurposeBacterial expression plasmid for KKH SaCas9 & sgRNA targeted to site 1: T7-humanSaCas9(E782K/N968K/R1015H)-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized KKH variant Staphylococcus aureus Cas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationE782K, N968K and R1015H in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI012-pGEM-PacI-PU3-BsmbI-NotI
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…PromoterAspergillus fumigatus U3 (RNAPIII).Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only