We narrowed to 3,226 results for: GRI;
-
Plasmid#221403PurposeMammalian expression of human integrin beta1 K418* full-lengthDepositorInsertintegrin beta1 K418* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* full-length
Plasmid#221404PurposeMammalian expression of human integrin beta1 N391* full-lengthDepositorInsertintegrin beta1 N391* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N562* full-length
Plasmid#221405PurposeMammalian expression of human integrin beta1 N562* full-lengthDepositorInsertintegrin beta1 N562* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
mouse b5 full length
Plasmid#217815PurposeFull length mouse integrin b5 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse av full length
Plasmid#217809PurposeFull length mouse integrin av expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse a2b full length
Plasmid#217812PurposeFull length mouse integrin a2b expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
human a5 full length
Plasmid#217818PurposeFull length human integrin a5 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human beta1 ecto
Plasmid#221398PurposeMammalian expression of human integrin beta1 ectodomainDepositorInsertintegrin beta1 ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 Q280* K418* full-length
Plasmid#221406PurposeMammalian expression of human integrin beta1 Q280* K418* full-lengthDepositorInsertintegrin beta1 Q280* K418* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* N562* full-length
Plasmid#221407PurposeMammalian expression of human integrin beta1 N391* N562* full-lengthDepositorInsertintegrin beta1 N391* N562* full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 Q280* K418* ectodomain
Plasmid#221399PurposeMammalian expression of human integrin beta1 Q280* K418* ectodomainDepositorInsertintegrin beta1 Q280* K418* ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Beta1 N391* N562* ectodomain
Plasmid#221400PurposeMammalian expression of human integrin beta1 N391* N562* ectodomainDepositorInsertintegrin beta1 N391* N562* ectodomain (ITGB1 Human)
TagsAVI tag, HRV3C cleavage site, basic coil, HA tag,…ExpressionMammalianMutationcodon optimized for human mature _1 residues Q1 t…Available SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG412
Plasmid#40087DepositorTypeEmpty backboneTagsDendra2 PAFP, S-peptide, and TEV protease cleavag…ExpressionWormPromoterpie-1Available SinceAug. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lact-C2-GFP-p416
Plasmid#22853DepositorInsertLactadherin-C2
TagsGFPExpressionYeastAvailable SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEG545
Plasmid#40116DepositorTypeEmpty backboneUseGateway donor vectorTagsDendra2 PAFP (sequence optimized for worm express…Available SinceSept. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
R-pre-GFP
Plasmid#17274DepositorInsertR-pre
TagsEGFPExpressionMammalianAvailable SinceApril 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
R-pre-mRFP
Plasmid#17275DepositorInsertR-pre
TagsmRFPExpressionMammalianAvailable SinceApril 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
KRphi-mRFP
Plasmid#17276DepositorInsertKR phi
TagsmRFPExpressionMammalianAvailable SinceApril 2, 2008AvailabilityAcademic Institutions and Nonprofits only