We narrowed to 7,149 results for: cas9 plasmid
-
Plasmid#124284PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMEG_YLCas9_empty
Plasmid#117826PurposeCRISPR/Cas9 plasmid for GoldenMOCS in Y. lipolyticaDepositorInsertYlpTEF_hCas9_YlCyc1TT
ExpressionBacterial and YeastAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBP_dCas9
Plasmid#190131PurposeLevel 0 MoClo plasmid containing dCas9DepositorInsertdCas9
UseCRISPRAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-dCas9-VP64-MS2-VP64-ZsG
Plasmid#192669PurposeDox-inducible expression of dCas9-VP64 with P2A MS2-VP64 and T2A ZsGreen1DepositorInsertdCas9-VP64, MS2-VP64, ZsGreen1
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterTRE3GAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-miniTurbo
Plasmid#219822PurposeEF1α-driven expression of dCas9 fused to miniTurbo with GFP (Adapted from plasmid #153209)DepositorInsertdCas9
UseCRISPRTagsminiTurboExpressionMammalianMutationD10A/H841APromoterEF1aAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-dCas9-VP64
Plasmid#141104PurposeExpression of gRNA and dCas9-VP64 from the same plasmid for CRISPRaDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-BFP-PGK-Blast
Plasmid#196720PurposeTet-inducible expression of Cas9-T2A-TagBFPDepositorInsertCas9-T2A-TagBFP
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSPromoterTRE, PGKAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-miRFP670nano-PGK-Blast
Plasmid#196722PurposeTet-inducible expression of Cas9-T2A-miRFP670nanoDepositorInsertCas9-T2A-miRFP670nano
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSPromoterTRE, PGKAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1656)
Plasmid#160618PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).DepositorInsertTnos:NptII:Pnos-SF-P35s:hCas9:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-spCas9-WPRE-miR124T
Plasmid#245071PurposeCRISPR Editing with SpCas9, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertCas9, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1657)
Plasmid#160640PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).DepositorInsertTnos:NptII:Pnos-SF-P35s:hCas9:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-miRFP670
Plasmid#91854PurposeCas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988DepositorInsertshSpCas9-2A-miRFP670
BB-guide RNA
UseCRISPRTags2A-miRFP670 and 3XFLAGExpressionMammalianPromoterCbh and U6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-KRAB-MECP2-H2B-mCherry (CRISPRi)
Plasmid#175574PurposeInactivated Cas9 (dCas9) fusion to KRAB and MeCP2 for the purpose of targeted repressionDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-KRAB-MECP2-H2B-GFP (CRISPRi)
Plasmid#175573PurposeInactivated Cas9 (dCas9) fusion to KRAB and MeCP2 for the purpose of targeted repressionDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9
Plasmid#42876PurposeBacterial expression of Cas9 nuclease, tracrRNA and crRNA guideDepositorInserttracr/Cas9
UseCRISPR; E.coliExpressionBacterialAvailable SinceFeb. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-EF1a-dCas9-HA-BFP-KRAB-NLS
Plasmid#102244PurposeLentiviral expression of dCas9-HA-BFP-KRAB-NLS for CRISPRi driven by a hEF1alpha promoterDepositorInsertdCas9-HA-BFP-KRAB-NLS
UseCRISPR and LentiviralTagsHA-TagBFP-KRAB-NLSExpressionMammalianPromoterEF1aAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only