We narrowed to 3,405 results for: zebrafish
-
Plasmid#254761PurposeRabep1 gRNAs for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only
-
Tol2-LyzC-GFP-pa-u6ac-Arhgap20-guides
Plasmid#254763PurposeArhgap20 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Vamp8-guides
Plasmid#254764PurposeVamp8 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDD3248 pCS2-mtagBFP2-p2a-NES-arrb2a-(ENLYFQ/S)x3-SV40NLS-sfCherry3C(1-10)
Plasmid#251770PurposeBlue fluorescent protein-tagged TEVp substrate (three-peat motif) for fluorescent protein reconstitution assayDepositorInsertarrestin, beta 2a (arrb2a Zebrafish)
TagsNLS (SV40), sfCherry3C large fragment and mTagBFP…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_Del4UC1_EGFP
Plasmid#229691PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish mutant Cavin1 (Del4UC1)DepositorUseLentiviralTagsEGFPMutationDel4UC1PromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_DrCavin1b_EGFP
Plasmid#229690PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPPromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCavin1b
Plasmid#194292PurposeMultisite gateway entry clone for expression of codon optimised zebrafish cavin1b with fusion tag at the N-terminus. Parton lab clone KXJDepositorInsertcavin1b (cavin1b Zebrafish)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-lmo2
Plasmid#164657Purposefor the synthesis of zebrafish lmo2 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-SERCA1
Plasmid#109552PurposeMultisite gateway vector for 3' tagging with sarcoplasmic/endoplasmic calcium ATPase 1DepositorInsertsarcoplasmic/endoplasmic calcium ATPase 1 (atp2a1 Zebrafish)
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl C
Plasmid#89372PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl B
Plasmid#89371PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl D
Plasmid#89373PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl A
Plasmid#89370PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGCS vector kit
Plasmid Kit#1000000107PurposeGateway destination vectors for high-level expression of mRNAs or proteins in a variety of vertebrate organisms.DepositorApplicationGene Expression and LabelingVector TypeAvian Expression, Mammalian Expression, Xenopus Expression, Zebrafish ExpressionAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only