We narrowed to 4,660 results for: BRE
-
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_3xflag_CHEK2
Plasmid#136526PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorAvailabilityAcademic Institutions and Nonprofits only -
pAAV-eHGT_78h-Cre_PEST
Plasmid#231791PurposeExpresses Cre in excitatory neurons; Cre expression is attenuated by PEST sequence.DepositorInsertCre
UseAAVTagsPESTPromoterminBetaGlobinAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA hygro
Plasmid#104991PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and hygromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 hygro
Plasmid#104995PurposeThis lentiviral construct delivers hSpCas9 and hygromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRM210 LGP (Luciferase GFP Puro)
Plasmid#174722PurposeExpresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance geneDepositorInsertsFirefly Luciferase
eGFP
pac
UseLentiviral and LuciferaseTagsE2A linker and F2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-eGFP…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA blast
Plasmid#104993PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and blasticidin S resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 blast
Plasmid#104997PurposeThis lentiviral construct delivers hSpCas9 and blasticidin S resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA puro
Plasmid#104990PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and puromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 neo
Plasmid#104996PurposeThis lentiviral construct delivers hSpCas9 and G418 resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
PARP1 FL
Plasmid#169815PurposeExpresses codon optimised full length His tagged PARP1 in bacterial cellsDepositorInsertPoly[ADP-ribose] polymerase 1 (PARP1 Human, Codon optimised, Synthetic)
TagsMKHHHHHHMKQExpressionBacterialMutationValine 762 mutated to an alaninePromoterT7 promoterAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 puro
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro /BRAF-V600E
Plasmid#131724PurposeMammalian Expression of Flag tagged BRAFDepositorInsertBRAF (BRAF Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationV600EPromoterCMVAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only