We narrowed to 11,638 results for: nar
-
Plasmid#103085PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B8I085
Plasmid#103089PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB8I085(Cas9 coding gene from Clostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q5L8F8
Plasmid#103126PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ5L8F8(Cas9 coding gene from Bacteroides fragilis (strain ATCC 25285 / NCTC 9343))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SLX4-SFB-D409-555
Plasmid#247859PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged SLX4 D409-555DepositorInsertSLX4 (SLX4 Human)
TagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 409-555Available SinceApril 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_NLS_ K682R_K686R_K694R_K709R (4KR) POLH_deltaGG NEDD8
Plasmid#250151PurposeExpresses GFP-tagged K682R_K686R_K694R_K709R POLH fused to ΔGG NEDD8 in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_NLS_ K682R_K686R_K69R_K709R POLH (4KR)
Plasmid#246408PurposeExpresses K682R_K686R_K694R_K709R POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_NLS_ K682A_K686A_K694A_K709A (4KA) POLH_deltaGG Ubiquitin
Plasmid#246409PurposeExpresses GFP-tagged K682A_K686A_K694A_K709A POLH fused to ΔGG ubiquitin in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_NLS_ K682R_K686R_K694R_K709R (4KR) POLH_deltaGG Ubiquitin
Plasmid#246410PurposeExpresses GFP-tagged K682R_K686R_K694R_K709R POLH fused to ΔGG ubiquitin in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-HA_WT POLH_deltaGG NEDD8
Plasmid#246412PurposeExpresses HA-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsHA and ΔGG NEDD8ExpressionMammalianMutationCoding sequence has been optimised for expression…Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_L704A_F707A_F708A (PIP2*) POLH
Plasmid#246283PurposeExpresses L704A_F707A_F708A POLH with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH L704A_F707A_F708A. Coding sequence has been …Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_POLH_ΔGG NEDD8
Plasmid#221870PurposeExpresses GFP-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_D652A POLH
Plasmid#221871PurposeExpresses D652A POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_K682A_K686A_K694A_K709A POLH
Plasmid#221872PurposeExpresses K682A_K686A_K694A_K709A POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsNLS-EGFPExpressionMammalianMutationK682A, K686A, K694A, K709APromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_L704A_F707A_F708A POLH
Plasmid#221873PurposeExpresses PIP box-mutated POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-N-DYK_K164R PCNA_ΔGG ubiquitin
Plasmid#221875PurposeExpresses FLAG-tagged K164R PCNA fused with ΔGG Ubiquitin in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsFLAG and Ubiquitin ΔGGExpressionMammalianMutationK164RPromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLH
Plasmid#221897PurposeExpresses WT POLH with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_D652A POLH
Plasmid#222006PurposeExpresses D652A POLH with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH D652A. Coding sequence has been optimised fo…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A POLH
Plasmid#221862PurposeExpresses POLH mutated at K682A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A. Coding sequence has been optimised fo…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K709A POLH
Plasmid#221863PurposeExpresses POLH mutated at K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K709A. Coding sequence has been optimised fo…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only