We narrowed to 43,024 results for: gats
-
Plasmid#111453PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
Tags8xHis and EGFPExpressionMammalianMutationKv7.4 (1-695)Available SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5E-CAGGS (JDW 912)
Plasmid#224472PurposeGateway compatible 5' entry clone containing the CAG promoter for constitutive expression of downstream constructs.DepositorInsertCAGGS Promoter
ExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-Hemagglutinin-esterase
Plasmid#168943PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-Hemagglutinin-esterase (HE )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA pCAGGS
Plasmid#206076Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain IIDepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pCI-neo-hApg5(K130R)-HA
Plasmid#22949DepositorInsertHomo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) (ATG5 Human)
Tags3xHAExpressionMammalianMutation130 Lysine to ArginineAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pME V5-mTagBFP2 (JDW 830)
Plasmid#224484PurposeGateway compatible middle entry clone containing V5 tagged mTagBFP2 (Cytosolic blue fluorescent reporter)DepositorInsertV5-mTagBFP2
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-V5-mScarlet-I_SV40pA (JDW 968)
Plasmid#224529PurposeA Gateway compatible 3' entry clone containing an V5 mScarlet fusion followed by SV40 late polyADepositorInsertV5-mScarlet-I
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-GABARAPL2 G116A
Plasmid#123104PurposeExpresses 3xFLAG-GABARAPL2 G116A in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
Tags3xFLAGExpressionMammalianMutationGlycine 116 to AlaninePromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
Kv7.4 (1-645, Δ368-523)/pcDNA3.1
Plasmid#111456PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
ExpressionMammalianMutationKv7.4 (1-645, Δ368-523), C643AAvailable SinceMay 15, 2021AvailabilityAcademic Institutions and Nonprofits only